ID: 1091551587

View in Genome Browser
Species Human (GRCh38)
Location 12:1539159-1539181
Sequence GTCCCGTGGGGAGAGCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091551579_1091551587 5 Left 1091551579 12:1539131-1539153 CCAAAAATGTCTCTGGACATTGC 0: 10
1: 71
2: 408
3: 869
4: 1323
Right 1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 311
1091551576_1091551587 24 Left 1091551576 12:1539112-1539134 CCACTCCGAAGGATGACAACCAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 311
1091551575_1091551587 25 Left 1091551575 12:1539111-1539133 CCCACTCCGAAGGATGACAACCA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 311
1091551574_1091551587 26 Left 1091551574 12:1539110-1539132 CCCCACTCCGAAGGATGACAACC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 311
1091551577_1091551587 19 Left 1091551577 12:1539117-1539139 CCGAAGGATGACAACCAAAAATG 0: 1
1: 1
2: 22
3: 167
4: 806
Right 1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091551587 Original CRISPR GTCCCGTGGGGAGAGCGGGA GGG Intronic
900030687 1:370364-370386 CTCCCGTGGGGAGACCTGGCAGG - Intergenic
900051304 1:599039-599061 CTCCCGTGGGGAGACCTGGCAGG - Intergenic
900530896 1:3152729-3152751 GTCCCCTGGGGAGGGCTGCATGG + Intronic
900582435 1:3415724-3415746 GGCCCGTGGGGGCAGCGGGCAGG - Intronic
901030899 1:6306196-6306218 AGACCGTGGGGAGAGGGGGAGGG + Intronic
901065065 1:6490521-6490543 GGCGCGCGGGGAGAGGGGGACGG + Intronic
901625728 1:10623869-10623891 GTCAGGTGGGGAGGGTGGGAAGG + Intronic
904359804 1:29963951-29963973 GTGCCGTGGGGAGCCCTGGAGGG + Intergenic
904611287 1:31727603-31727625 ATCCTGTGGAGGGAGCGGGAGGG + Exonic
904940722 1:34163869-34163891 GTGCTGTGGGTAAAGCGGGAGGG + Intronic
907871616 1:58448807-58448829 GTCCAGTGGTGAGACAGGGAAGG - Intronic
908778411 1:67665316-67665338 GTGGGGTGGGGAGAGGGGGAAGG - Intergenic
911150115 1:94590345-94590367 GGGCCCTGGGGAGAGAGGGAGGG - Intergenic
911930424 1:103895900-103895922 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
911963051 1:104332143-104332165 GTGGCGTGGGGAGTGAGGGAGGG - Intergenic
912081946 1:105948031-105948053 GTGGGGTGGGGAGAGGGGGAGGG - Intergenic
914775449 1:150729957-150729979 AGACCGTGGGGAGAGGGGGAGGG + Intergenic
915724266 1:158006759-158006781 CTCCCGTGGAGAGAGGAGGAGGG - Intronic
917536516 1:175878178-175878200 GTCCCTCTGGGAGAGCCGGAGGG + Intergenic
918221581 1:182440644-182440666 AGACCGTGGGGAGAGGGGGAGGG + Intergenic
919079814 1:192856364-192856386 AGACCGTGGGGAGAGGGGGAGGG - Intergenic
920605437 1:207378863-207378885 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
921108986 1:212014559-212014581 AGACCGTGGGGAGAGGGGGAGGG - Intronic
921415423 1:214880610-214880632 GTGTGGTGGGGGGAGCGGGAGGG + Intergenic
922526733 1:226309524-226309546 GTTCCGAGTGGAGAACGGGAGGG + Exonic
924150840 1:241127541-241127563 GTGGCGTGGGGGGAGCGGGGAGG + Intronic
1067195822 10:44117131-44117153 GACCCCTGGGGAGAGAGGCAGGG + Intergenic
1067354292 10:45511389-45511411 GGGCCGTGGGGAGAGGGAGAGGG - Intronic
1067521513 10:47010622-47010644 CTACAGTGGGGAGAGAGGGAGGG - Intergenic
1071792568 10:88970718-88970740 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1072321635 10:94255963-94255985 GGGGCGTGGGGAGAGAGGGAGGG - Intronic
1072619253 10:97068704-97068726 ATGCCATGGGGAGAGCAGGAAGG - Intronic
1074786824 10:116849139-116849161 GGCGCGTGGGGAGGGCGGGGTGG + Intergenic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1078040379 11:7856113-7856135 GTGTGGTGGGGAGAGAGGGAGGG - Intergenic
1078363012 11:10684456-10684478 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1078436569 11:11330480-11330502 GTCCCGTGGAGAAGGCAGGAGGG + Intronic
1079810714 11:24996760-24996782 GTGGGGTGGGGAGAGGGGGAGGG - Intronic
1080383562 11:31797594-31797616 ACCCCGCGGGGAGAGCGGCACGG + Intronic
1081039961 11:38197723-38197745 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1081525637 11:43925693-43925715 GCCCTGTGGGGAGAGGTGGAAGG + Intronic
1082102587 11:48185494-48185516 GTGGGGTGGGGAGAGGGGGAAGG - Intergenic
1083593585 11:63908772-63908794 GCCCAGAGAGGAGAGCGGGAGGG - Intronic
1083597051 11:63922966-63922988 GGACTGTGGGGAGAGCAGGAAGG - Intergenic
1088729064 11:112664699-112664721 GTCATGTGGGAAGAGAGGGAAGG + Intergenic
1089634894 11:119805771-119805793 GTGCCGTGAGGAGAGGGGTAGGG + Intergenic
1089815643 11:121172330-121172352 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1090233795 11:125131160-125131182 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG + Intronic
1092294895 12:7189865-7189887 GGGCGGTGGGGAGCGCGGGAGGG + Intronic
1092549399 12:9481637-9481659 ATGCAGTGGGGAGAGGGGGAGGG + Intergenic
1093285365 12:17253240-17253262 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1094097178 12:26719745-26719767 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1094521865 12:31199507-31199529 GTGCAGTGGGGAGAGGGGGAGGG - Intergenic
1096070816 12:48774607-48774629 GTCACATGGGGAGAGGGAGAAGG - Intronic
1096233854 12:49912689-49912711 GTCCCGCAGGCAGAGCAGGAAGG - Intergenic
1096278293 12:50229543-50229565 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1096514517 12:52148613-52148635 GTGCAGTGGGGTGAGCGGGCGGG + Intergenic
1096776119 12:53965457-53965479 GTTCCTGGGGGAGAGGGGGAAGG - Intergenic
1098921954 12:76310823-76310845 CTTCCGTAGGGAGAGGGGGAAGG - Intergenic
1099841211 12:87969902-87969924 GTGGGGTGGGGGGAGCGGGAAGG - Intergenic
1100632183 12:96400142-96400164 GACCCGCGGCGAGAGCCGGAAGG - Exonic
1101283767 12:103287554-103287576 GTGGGGTGGGGAGAGGGGGAAGG + Intronic
1101850808 12:108400507-108400529 TCCCCGTGGGGAGGGAGGGAAGG - Intergenic
1103141374 12:118551640-118551662 CTCTTGTGGGGAGAGCGGAATGG + Intergenic
1103564877 12:121810555-121810577 GGCCAGTGGGGAGAGCTGGGAGG - Exonic
1104940311 12:132392044-132392066 GGTCCCTGGGGAGAGCGGGGTGG - Intergenic
1104940324 12:132392073-132392095 GGTCCCTGGGGAGAGCGGGGTGG - Intergenic
1105900229 13:24746663-24746685 TGCGCGTGGGGAGAGCGGGGAGG + Intergenic
1106495059 13:30269070-30269092 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1108608362 13:52063027-52063049 GGACCGTGGGGAGAGGGAGAGGG - Intronic
1111604049 13:90514633-90514655 GTGCAGAGTGGAGAGCGGGAGGG + Intergenic
1111640374 13:90961920-90961942 GTGCGGTGGGGGGAGCGGGGAGG + Intergenic
1114659439 14:24335119-24335141 GTCCCGTCGGGGAAGTGGGAGGG - Intronic
1115288587 14:31745193-31745215 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1115724138 14:36194641-36194663 GTACAGAGGGGAGAGGGGGAGGG + Intergenic
1116772542 14:49144097-49144119 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1116895490 14:50311897-50311919 GTCCCGGGGTGAGAGCAGGTTGG - Intronic
1117194291 14:53324054-53324076 GTCGGGTGGGGGGAGCGGGGAGG + Intergenic
1118183991 14:63521957-63521979 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1119595178 14:75926078-75926100 GGGCCGTGGGGAGAGGGAGAGGG + Intronic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1120892705 14:89505288-89505310 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1121143092 14:91558388-91558410 GGACCGTGGGGAGAGGGAGAGGG + Intergenic
1122745846 14:103896789-103896811 GGCCTGTGGGGGGAGTGGGAGGG + Intergenic
1123118099 14:105903790-105903812 GTCCACTGGGGAGAGAGGCAGGG + Intergenic
1123705374 15:22947380-22947402 GTGCCCTCGGGAGAGCGGGAAGG - Intronic
1125481703 15:40085561-40085583 GAGAGGTGGGGAGAGCGGGAGGG - Intergenic
1125557096 15:40594735-40594757 GTCCCTAGGGAAGAGCGGCAGGG - Intronic
1126781659 15:52144165-52144187 TTCCCATGGGGGTAGCGGGACGG - Intronic
1127783151 15:62333317-62333339 GGGCCGTGGGGAGAGGGAGAGGG + Intergenic
1127856768 15:62960014-62960036 ATACTGTGGGGAGAGGGGGATGG + Intergenic
1128084407 15:64875847-64875869 AGCCCCTGGGGAGGGCGGGATGG + Intronic
1128943789 15:71808482-71808504 TGCCCGAGGAGAGAGCGGGAAGG + Intronic
1129270596 15:74417441-74417463 GTCCCCTGGGGTCAGTGGGAGGG + Exonic
1129438077 15:75558517-75558539 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1132415229 15:101614525-101614547 GGCCACTGGGGAGAGCTGGAAGG + Intergenic
1136231586 16:28888767-28888789 GACCTGTGGGGAGGGAGGGAGGG - Exonic
1136417902 16:30114527-30114549 GCCCCGTGGGGAGGGCGGGTGGG + Exonic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1137303719 16:47180371-47180393 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1137707721 16:50547574-50547596 GTCGCGCGGGGGGAGGGGGATGG - Intergenic
1139209899 16:65067033-65067055 GTGTGGTGGGGAGAGCTGGAGGG + Intronic
1139778310 16:69330709-69330731 CTCCCGGGAGGAGAGCGGAAGGG - Intronic
1140353886 16:74287948-74287970 GGCACATGGGGAGAGAGGGATGG + Intergenic
1141740382 16:85887819-85887841 GTATTGTGGGGAGAGTGGGAGGG - Intergenic
1142291607 16:89195850-89195872 GAGCCGTGGGGACAGCGTGAAGG - Exonic
1142799618 17:2337222-2337244 GTCCCGTCGGGAGAGGGAGCAGG + Exonic
1142986582 17:3698693-3698715 GTGCCGTGGGGAGTTCAGGAGGG - Intergenic
1143174765 17:4949600-4949622 GCCACCTGGGGAGGGCGGGACGG + Intronic
1143564808 17:7715086-7715108 GTCCCCAGGGGAGATGGGGATGG + Intergenic
1144834288 17:18148810-18148832 GTCCAGTGGGCAGAGCTGGCTGG + Exonic
1144849949 17:18239023-18239045 GTCCCCCTGGGAGAGCTGGATGG - Intronic
1146919128 17:36698204-36698226 CTCCCGAGGGGAGAGCTGGGGGG + Intergenic
1148348628 17:46922332-46922354 GTGGGGTGGGGAGAGGGGGAAGG + Intergenic
1150527169 17:65936804-65936826 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1151573567 17:74939542-74939564 GTCCGGTGGGGAGAGCATGCTGG + Intronic
1152038478 17:77888103-77888125 GTCCCTTTGGGGGAGCAGGAGGG - Intergenic
1152755836 17:82086652-82086674 ATCCTGTGGGCAGAGCGGGGTGG - Intronic
1152948926 17:83215041-83215063 CTCCCGTGGGGAGACCTGGCAGG + Intergenic
1153186337 18:2490510-2490532 GTGGCGTGGGGGGAGGGGGAGGG + Intergenic
1156066515 18:33148460-33148482 AGACCGTGGGGAGAGGGGGAGGG + Intronic
1156187806 18:34684075-34684097 GTCACGTTGGGAGAGAGGGATGG + Intronic
1156443226 18:37213290-37213312 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1157571233 18:48713637-48713659 GTCCTGTGAGGAGTGCTGGAGGG + Intronic
1157584763 18:48794018-48794040 CTCCCCTGGGGAGATGGGGATGG - Intronic
1160497559 18:79384110-79384132 CTGCCGTGGGGAGAGAGAGAGGG + Intergenic
1160707674 19:536993-537015 GTCCTGTGGGGAGAGTGGGTCGG - Exonic
1160868499 19:1266590-1266612 GCCCCGTGGGGAGGGCGGAGTGG + Intronic
1160947193 19:1649123-1649145 GCCCGGTGGGGAGGGCGGGGCGG - Intronic
1161457479 19:4376772-4376794 GCCCCGTGAGGATAGCAGGAGGG - Intronic
1161548411 19:4896562-4896584 GTCCCATGGGGAGAAGGGAAGGG - Intronic
1164555767 19:29249782-29249804 GTGGGGTGGGCAGAGCGGGAGGG - Intergenic
1165563054 19:36698066-36698088 GTCGGGTGGGGAGAGGGGGGAGG - Intronic
1166826564 19:45613514-45613536 GTCCCTTGGGGAGATGGGGATGG - Intronic
1167045485 19:47046559-47046581 GTTCCGTGGGGCGAGAGGGGGGG + Intronic
1167649021 19:50719553-50719575 GACCGGGGGGGAGGGCGGGAGGG + Intergenic
1167692596 19:50995966-50995988 GCCCTGTGGGGAGGGCTGGATGG - Intergenic
1168079393 19:53998443-53998465 GTCCCCTGGGGAGTGCTGGCGGG + Intronic
925079986 2:1056252-1056274 GTGCTGTGGGGAGGGAGGGAGGG + Intronic
925079998 2:1056287-1056309 GTGCTGTGGGGAGGGAGGGAGGG + Intronic
925080053 2:1056459-1056481 GTGCTGTGGGGAGGGAGGGAGGG + Intronic
925080185 2:1056912-1056934 GTGCTGTGGGGAGGGAGGGAGGG + Intronic
925291763 2:2752590-2752612 GTCCTGTGGGCAGGGAGGGAGGG + Intergenic
925383323 2:3443935-3443957 GTCCTGTGGGGAGGGCGTGGAGG - Intronic
925412155 2:3646016-3646038 CTCCGGTGGGGAGACAGGGAAGG - Intergenic
929746770 2:44667322-44667344 GTCCTCAGGGGAGAGCCGGATGG - Intronic
932410451 2:71543898-71543920 AGACCGTGGGGAGAGGGGGAGGG + Intronic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
932445828 2:71780634-71780656 GTCCAGAGGGGAGAGCTGAAGGG + Intergenic
937883809 2:126886780-126886802 GTGGCGTGGGGAGGGAGGGACGG - Intergenic
938829300 2:135034813-135034835 GGGCTGTGGGGAGAGGGGGAGGG + Intronic
939992360 2:148887808-148887830 CTAGCGTGGGGAGGGCGGGAAGG - Intronic
940623413 2:156142693-156142715 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
941295802 2:163736689-163736711 GTCCCGTGCGCAGAGGGGGTGGG - Intergenic
942790152 2:179752076-179752098 GTGGGGTGGGGAGAGGGGGAGGG - Intronic
943097530 2:183448449-183448471 GTGGTGTGGGGAGAGCGGGGAGG - Intergenic
944011980 2:194983818-194983840 GTTGGGTGGGGGGAGCGGGAAGG + Intergenic
944815757 2:203373477-203373499 GGGCCGTGGGGAGAGGGAGAGGG + Intronic
945188992 2:207166788-207166810 AGCCCGTGGGGAGTTCGGGAAGG - Intronic
948874476 2:240819599-240819621 GGCCCGAGGGGAGAGCGCGCAGG - Intronic
1169066448 20:2696783-2696805 CTCCCGTGGGCAGGGTGGGAGGG - Intronic
1169498703 20:6138799-6138821 GTCCCCTGAGGAGAGGGGAATGG - Intergenic
1171058583 20:21932945-21932967 GTGGGGTGGGGGGAGCGGGAGGG + Intergenic
1171366325 20:24627117-24627139 GGACCGTGGGGAGAGGGAGAGGG + Intronic
1171741567 20:28899890-28899912 GTCCAGTGTGGGGAGGGGGAGGG - Intergenic
1172174160 20:32962101-32962123 GTCCCGTGTGCAGAGAGGGCTGG + Intergenic
1172199438 20:33114951-33114973 AGACCGTGGGGAGAGGGGGAGGG - Intergenic
1172905544 20:38366567-38366589 GCCCCCCGGGGAGAGCGGGCAGG + Intronic
1173822609 20:46029070-46029092 GTTTTGGGGGGAGAGCGGGAGGG - Intronic
1176097310 20:63350047-63350069 GTGCCGTGGGGCGGGCGGCAGGG + Exonic
1176214021 20:63939748-63939770 CTCCCATGGGGAGGGAGGGAGGG - Intergenic
1176548775 21:8212870-8212892 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176556670 21:8257079-8257101 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176567706 21:8395905-8395927 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176575609 21:8440121-8440143 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1176980442 21:15375520-15375542 GAACAGTGGGGAGAGGGGGAGGG + Intergenic
1178738446 21:35174235-35174257 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
1178754717 21:35337529-35337551 GTCCCGTAGGGGGAGCTGAATGG + Intronic
1178985383 21:37298658-37298680 GTCCCCTGGGAAGGGAGGGATGG + Intergenic
1180022397 21:45136620-45136642 GTCCTGTGGGGACAGCTGGCGGG + Intronic
1180727233 22:17955402-17955424 GTTCCCTGTGGAGAGTGGGATGG - Intronic
1181997862 22:26897315-26897337 GGCCCGTGGGAAGAGCAGGGTGG - Intergenic
1182199194 22:28552775-28552797 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1183077099 22:35434040-35434062 GTTTCGTGGGGAGAGAGGCAGGG + Intergenic
1183508109 22:38220503-38220525 GTCCGGCAGGGAGACCGGGAGGG - Exonic
1183655830 22:39184215-39184237 GTCCTGTTGGGAGAGAGGAAGGG + Intergenic
1184435984 22:44477038-44477060 GTCACGAGTGGAGAGCGGGGTGG - Intergenic
1185149512 22:49156017-49156039 ATCGCGTGTGCAGAGCGGGAGGG - Intergenic
1203253660 22_KI270733v1_random:129175-129197 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1203261716 22_KI270733v1_random:174254-174276 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
951499886 3:23373320-23373342 GTCCTGTGGGGTAAGCAGGAAGG + Intronic
951792137 3:26497669-26497691 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
952728194 3:36611583-36611605 GTGGGGTGGGGAGAGGGGGAAGG + Intergenic
953947976 3:47164771-47164793 GCCCCGAGGGCACAGCGGGAAGG - Intergenic
954411620 3:50373630-50373652 CTGGGGTGGGGAGAGCGGGAGGG + Intronic
955941338 3:64149477-64149499 TTCCCGTGGGGAGAGCCTGCTGG + Intronic
958496647 3:94851875-94851897 GTGGGGTGGGGAGAGGGGGAGGG + Intergenic
958545349 3:95541591-95541613 GTGCAGTGGGGGGAGCGGGGAGG - Intergenic
960643842 3:119855828-119855850 GTGCGGTGGGGGGAGGGGGAGGG + Intronic
960702493 3:120451345-120451367 GTGCCGTGGGGGGCCCGGGAAGG + Intergenic
960915414 3:122689635-122689657 GGCCCGTGGTGAGAGAAGGATGG - Intronic
961491077 3:127257264-127257286 GTGCAGTGGGGAGAGGGGAAAGG - Intergenic
963477099 3:145821403-145821425 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
963666798 3:148198420-148198442 GTGGGGTGGGGAGAGGGGGAAGG - Intergenic
963776552 3:149445751-149445773 AGACCGTGGGGAGAGGGGGAGGG + Intergenic
963799592 3:149662569-149662591 GTCCTGTCGTGAGAGTGGGAAGG - Intronic
966499137 3:180618549-180618571 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
966543662 3:181120174-181120196 GTGAGGTGGGGAGAGGGGGAAGG + Intergenic
967860665 3:194148887-194148909 GTCCCAGGGAGAGGGCGGGAGGG - Intergenic
967919615 3:194604588-194604610 CTGCCCTGGGGAGAGCTGGATGG - Intronic
969105042 4:4800882-4800904 ATCCAGTGGGGAAAGCAGGAAGG + Intergenic
969325798 4:6443149-6443171 GTGCCGAGGAGAGAGAGGGAAGG - Intronic
969540875 4:7788042-7788064 CTCCAGTGGGGAGAGCAGGCAGG - Intronic
972061419 4:34878267-34878289 GTGCCGTGGGGTGAGAGGCAAGG + Intergenic
974770302 4:66403338-66403360 GTGGGGTGGGGAGAGGGGGAAGG + Intergenic
974775746 4:66478229-66478251 GTCAGGTGGGGAGAGGGGGGAGG - Intergenic
975050070 4:69851973-69851995 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
975543045 4:75533902-75533924 GTGCGGTGGGGGGAGGGGGAGGG - Intronic
976607240 4:86995300-86995322 AGACCGTGGGGAGAGGGGGAGGG - Intronic
977823858 4:101507053-101507075 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
980591867 4:134901212-134901234 GTGCAGTGGGGGGAGGGGGAGGG - Intergenic
982075140 4:151731107-151731129 AGACCGTGGGGAGAGGGGGAGGG - Intronic
983362953 4:166749486-166749508 GTGCGGTGGGGGGAGCGGGGAGG + Intronic
985604550 5:851328-851350 GTCAGGTGGGGAGGGCGGCAGGG + Intronic
985814663 5:2117725-2117747 GCTCTGTGGGGAGATCGGGAGGG - Intergenic
987205641 5:15622428-15622450 GTCGGGTGGGGAGAGCGGGGAGG - Intronic
988114529 5:26867627-26867649 GTGCCGTGGGGGGAGGGGGGAGG - Intergenic
988221757 5:28355045-28355067 GTCGGGTGGGGAGAGGGGGGAGG + Intergenic
989787852 5:45352374-45352396 GTGCAGTGGGGGGAGGGGGAGGG + Intronic
990360874 5:55018192-55018214 GTGCGGTGGGGGGAGGGGGAAGG + Intronic
991041974 5:62185662-62185684 GCCACCTGGGGAGAGAGGGAAGG + Intergenic
992911648 5:81401219-81401241 GTCCAGTGGGGAGGTCGGGAGGG - Intergenic
998114706 5:139527284-139527306 CTACTGTGGGGAGAGGGGGAAGG - Intronic
999009555 5:148021052-148021074 GTGCGGTGGGGGGAGCGGGGAGG - Intergenic
1000381297 5:160632073-160632095 GTTCTGTGGGAAGAGAGGGAGGG - Intronic
1000384711 5:160663638-160663660 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1000663880 5:163970777-163970799 GTCGAGTGGGGAGAGCGGGGAGG - Intergenic
1002342159 5:178524303-178524325 TTCCACTGGGGAGAGCGGGCAGG - Intronic
1002395026 5:178946026-178946048 GTCCCCTGGGGTGAGCGGAGAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002743133 5:181448504-181448526 CTCCCGTGGGGAGACCTGGCAGG + Intergenic
1005843658 6:29761183-29761205 GTCCCATGTGGAGATAGGGAAGG - Intergenic
1007400302 6:41599247-41599269 GCCCTGTGGGGAGAGCTGGTGGG - Exonic
1010854948 6:80825986-80826008 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1012061577 6:94490703-94490725 GTGGGGTGGGGAGAGGGGGAGGG + Intergenic
1012479554 6:99651039-99651061 AGACCGTGGGGAGAGGGGGAGGG + Intergenic
1012983876 6:105854902-105854924 GGGCCGTGGGGAGAGGGGGAGGG + Intergenic
1013261619 6:108449743-108449765 GTTGGGTGGGGAGAGGGGGAAGG - Intronic
1014711430 6:124810482-124810504 GTGGGGTGGGGGGAGCGGGAAGG + Intronic
1019248233 6:170723917-170723939 CTCCCGTGGGGAGACCTGGCAGG + Intergenic
1019537905 7:1538471-1538493 GGCCTGTGGGGAGGGCGGGGCGG + Intronic
1024599261 7:50965067-50965089 GTGCGGTGGGGGGAGGGGGAAGG - Intergenic
1027390332 7:77697060-77697082 GTGCCGTGCGGGGAGGGGGAGGG + Intronic
1028759466 7:94479507-94479529 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1029680840 7:102107907-102107929 GTCCCTGGGGGAGCGCGGCAGGG + Intronic
1030440375 7:109581640-109581662 GTCACCTGGGGAGAGTGGGGTGG - Intergenic
1035474376 7:159131547-159131569 GTCCTGTGGGGAGAGGGGCGAGG - Intronic
1035499869 8:83796-83818 CTCCCGTGGGGAGACCTGGCAGG - Intergenic
1036761388 8:11511292-11511314 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1036937405 8:13016753-13016775 GTCCTCTGGGGAAAGGGGGAAGG - Intronic
1039575800 8:38623123-38623145 ATCCCGTGGATAGAGCAGGATGG - Intergenic
1042998899 8:74733223-74733245 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1043485966 8:80699832-80699854 GTCCAGTGGGCAGAGTGGGTGGG - Intronic
1045065323 8:98438940-98438962 CACCCGTGGGGAGAAGGGGATGG + Intronic
1046103973 8:109644962-109644984 GTGCCGTGGGGAAATCGGGCGGG - Intronic
1046274473 8:111939268-111939290 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1048042127 8:130741120-130741142 TTCCCGTGGGGAGATAGAGAGGG - Intergenic
1048767645 8:137862285-137862307 GCCTCTTGGGGAGAGAGGGAGGG + Intergenic
1049055522 8:140233606-140233628 GTGTGGTGGGGAGAGAGGGAGGG - Intronic
1049206584 8:141366447-141366469 GTCCCGAGGGGGCAGCGGGCTGG - Intronic
1049329916 8:142044935-142044957 GGCACGTGAGGAGAGGGGGAGGG - Intergenic
1049531332 8:143157084-143157106 GTGCCGTGGGGTGAGGGGGCAGG - Intergenic
1049622721 8:143605878-143605900 GTCCCCTGAGGAGAGCGTTAGGG + Exonic
1049732471 8:144185696-144185718 GGACCGTGGGGGGAGGGGGAGGG + Intronic
1049732508 8:144185780-144185802 GGACCGTGGGGGGAGGGGGAGGG + Intronic
1050534749 9:6622249-6622271 AGACCGTGGGGAGAGGGGGAGGG - Intronic
1050995233 9:12209378-12209400 GTGGAGTGGGGAGAGGGGGAGGG - Intergenic
1051147883 9:14048230-14048252 GTCGGGTGGGGGGAGCGGGGAGG + Intergenic
1052941736 9:34136827-34136849 AGACCGTGGGGAGAGGGGGAGGG - Intergenic
1053129718 9:35608140-35608162 GTCCTGTGGGGACAGAAGGAGGG - Exonic
1053569423 9:39288474-39288496 GCCCCGGTGGGAGAGAGGGACGG - Intergenic
1053649066 9:40144897-40144919 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1053756677 9:41318994-41319016 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1053835384 9:42129495-42129517 GCCCCGGTGGGAGAGAGGGACGG - Intronic
1054091052 9:60847458-60847480 GCCCCGGTGGGAGAGAGGGACGG - Intergenic
1054112463 9:61123014-61123036 GCCCCGGTGGGAGAGAGGGACGG - Intergenic
1054127723 9:61330536-61330558 GCCCCGGTGGGAGAGAGGGACGG + Intergenic
1054330041 9:63742803-63742825 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1054535515 9:66231276-66231298 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1054595242 9:67059115-67059137 GCCCCGGTGGGAGAGAGGGACGG + Intergenic
1059996339 9:119913799-119913821 GTGCTGAGGGGAGAGAGGGAGGG - Intergenic
1060392431 9:123289324-123289346 GGGCAGTGGGGAGAGAGGGATGG - Intergenic
1060932508 9:127497773-127497795 GGCCCGTGGGGAGAAGGGGCAGG + Intronic
1060964630 9:127705774-127705796 GCCTTGTGGGGAGAGCGGGGAGG - Intronic
1060967554 9:127720396-127720418 GTACAGTGGGGAGGGCGGGCAGG + Intronic
1061007810 9:127938135-127938157 GTCCCGGGGCCAGAGTGGGATGG + Exonic
1061068906 9:128296603-128296625 GCCGCTTGGGGAGAGAGGGAAGG + Intergenic
1061142913 9:128779506-128779528 AGACCGTGGGGAGAGGGGGAGGG - Intergenic
1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG + Exonic
1062230589 9:135479783-135479805 GCGCCGTGGGAAGCGCGGGAGGG - Exonic
1062523493 9:136969203-136969225 GACCCGTGGGCAGAGCAGGGTGG + Intergenic
1062728698 9:138096330-138096352 GTCCCATGGGGAGAGCAGATCGG + Intronic
1203470060 Un_GL000220v1:112323-112345 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1203477881 Un_GL000220v1:156295-156317 GGCCCGCGGGGGGAGGGGGAAGG - Intergenic
1203383698 Un_KI270435v1:90926-90948 GTCCGGTGTGGGGAGGGGGAGGG + Intergenic
1203395118 Un_KI270512v1:20323-20345 GTCGGGTGGGGGGAGGGGGAAGG + Intergenic
1203403144 Un_KI270519v1:135376-135398 GTCGGGTGGGGGGAGGGGGAGGG + Intergenic
1203609014 Un_KI270748v1:79539-79561 CTCCCGTGGGGAGACCTGGCAGG + Intergenic
1203683389 Un_KI270757v1:9209-9231 GTCCGGTGTGGGGAGGGGGAGGG + Intergenic
1188268396 X:28107449-28107471 GTCCCTTGGGGTGAGGGTGAGGG + Intergenic
1188292119 X:28402040-28402062 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1190188947 X:48259593-48259615 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
1190723671 X:53172153-53172175 GTGCCCTGGGGAAAGGGGGATGG + Intergenic
1192496070 X:71617334-71617356 GTCCTGTGGGCAGGGCGGGGAGG + Exonic
1192951466 X:76021685-76021707 GTGCGGTGGGGGGAGGGGGATGG + Intergenic
1193132591 X:77932912-77932934 GGACCGTGGGGAGAGGGAGAGGG + Intronic
1195099512 X:101540809-101540831 GTCGGGTGGGGGGAGGGGGAGGG + Intergenic
1195727955 X:107936571-107936593 GTGGAGAGGGGAGAGCGGGAAGG + Intergenic
1196297995 X:114021273-114021295 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1197087526 X:122496827-122496849 GTGGGGTGGGGAGAGGGGGAGGG - Intergenic
1197764154 X:130048813-130048835 GGGCCTGGGGGAGAGCGGGAGGG - Intronic
1198336056 X:135667878-135667900 GTGGGGTGGGGGGAGCGGGAAGG - Intergenic