ID: 1091555058

View in Genome Browser
Species Human (GRCh38)
Location 12:1566798-1566820
Sequence CCCCTCGTGCCTCCTGCAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091555053_1091555058 10 Left 1091555053 12:1566765-1566787 CCCGAGTTCTCACAGTGAATAAT 0: 1
1: 0
2: 1
3: 22
4: 254
Right 1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1091555052_1091555058 11 Left 1091555052 12:1566764-1566786 CCCCGAGTTCTCACAGTGAATAA 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1091555054_1091555058 9 Left 1091555054 12:1566766-1566788 CCGAGTTCTCACAGTGAATAATG 0: 1
1: 0
2: 18
3: 77
4: 367
Right 1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1091555050_1091555058 29 Left 1091555050 12:1566746-1566768 CCTCACCTTCTGGAGCTTCCCCG 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1091555051_1091555058 24 Left 1091555051 12:1566751-1566773 CCTTCTGGAGCTTCCCCGAGTTC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1091555049_1091555058 30 Left 1091555049 12:1566745-1566767 CCCTCACCTTCTGGAGCTTCCCC 0: 1
1: 0
2: 2
3: 38
4: 339
Right 1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091555058 Original CRISPR CCCCTCGTGCCTCCTGCAGT GGG Exonic
900255633 1:1697169-1697191 CCCCAGGTGCCTCCTGCACAGGG + Intronic
900264304 1:1749792-1749814 CCCCAGGTGCCTCCTGCACAGGG + Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900545149 1:3224644-3224666 CCCCTCTGGCCACCTGCATTAGG + Intronic
901374978 1:8831518-8831540 CCCCTCATGCTTCCAGCAGGGGG + Intergenic
903314005 1:22486490-22486512 CCCCTCTTGCTTCCAGCAGCGGG - Intronic
904009092 1:27379885-27379907 CCCCTTTTGTCTCCTCCAGTTGG - Exonic
904261321 1:29289447-29289469 CTCCTCCTCACTCCTGCAGTAGG + Intronic
908793352 1:67804910-67804932 CCCCTCATGCTTCCAGCAGGGGG + Intronic
911697429 1:100906657-100906679 ACCCTCGTACCTCCTGCACAAGG - Intronic
913961199 1:143339210-143339232 CACCTGGTGTCTCCAGCAGTGGG + Intergenic
914055553 1:144164783-144164805 CACCTGGTGTCTCCAGCAGTGGG + Intergenic
914123593 1:144801579-144801601 CACCTGGTGTCTCCAGCAGTGGG - Intergenic
915466723 1:156102645-156102667 CGCCTCTGGCCTCCTGCAGCCGG + Intronic
917738208 1:177939154-177939176 CCCCAAGTTCCCCCTGCAGTAGG - Intronic
918051675 1:180978558-180978580 CCCCTCATGCTTCCAGCAGGCGG + Intronic
919797036 1:201327069-201327091 CCCATGGGGCCTGCTGCAGTGGG + Intronic
920965462 1:210697387-210697409 CCCGTGCTGCCTCCTGCAGGGGG + Intronic
921673854 1:217955605-217955627 CTCCTCATGCTTCCAGCAGTGGG + Intergenic
1062983880 10:1748557-1748579 CTCCTCCTGCCTCTAGCAGTGGG + Intergenic
1063832594 10:9972065-9972087 CCCCTTGTGCTCCCAGCAGTGGG + Intergenic
1064103913 10:12485368-12485390 CTCCTCGTGCCCCCTGTCGTGGG + Intronic
1067201008 10:44172013-44172035 CCCCTCATCCCTCCTGCTGCAGG - Intergenic
1067745889 10:48935375-48935397 CCCCCTGTGATTCCTGCAGTTGG + Intronic
1069569678 10:69486764-69486786 CTGCTGGGGCCTCCTGCAGTGGG + Intronic
1069633837 10:69913607-69913629 CGCCTCCTGCCTCCTGCACATGG + Intronic
1070168227 10:73913662-73913684 CCCCCGGTGCCTCCTGTAGATGG - Exonic
1070751150 10:78964662-78964684 GGGCTGGTGCCTCCTGCAGTGGG + Intergenic
1072119902 10:92397033-92397055 CCCCTCATGCTTCCTGCAGGGGG + Intergenic
1074465973 10:113680940-113680962 CCCCTCTTGCCTCTAGCAGCTGG - Intronic
1076507012 10:130984903-130984925 CCCCGCTCCCCTCCTGCAGTGGG + Intergenic
1076680666 10:132169698-132169720 CCACCTGTGTCTCCTGCAGTGGG + Intronic
1077174289 11:1181630-1181652 CCCCACCAGCCACCTGCAGTGGG + Intronic
1077309341 11:1881560-1881582 CCCCTCAGGACTCCTGCACTGGG - Exonic
1077319880 11:1936393-1936415 CCCCTCGTGCCTGCAGCCGGGGG + Intronic
1081717512 11:45260895-45260917 CCCCTCTTGCCTTCTGCCCTGGG + Intronic
1084948696 11:72652924-72652946 CCTCTCTTGCCTCCTCAAGTTGG + Intronic
1085517607 11:77120694-77120716 CCCCTCCCGCCTCCTGCAGGTGG + Exonic
1086511804 11:87566234-87566256 CCCCTAGTACCTACTGTAGTAGG - Intergenic
1086960008 11:92971752-92971774 CCCCTCCTGCATCCTACAGAGGG + Intronic
1088908431 11:114172102-114172124 CCCCTCAATCCTCCTGCTGTGGG + Intronic
1089158948 11:116423284-116423306 CCCCGCCTGCATCCTGCAGCTGG - Intergenic
1089262536 11:117232627-117232649 CCGCTCGTGCCGCCGGAAGTGGG + Exonic
1090190072 11:124761566-124761588 CCCCTCCTGCTTCCTGCCCTGGG - Intronic
1091013568 11:132028827-132028849 CCCCTCATGCATCCAGCAGGGGG - Intronic
1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG + Exonic
1093563983 12:20579668-20579690 CCCCTATTGCCTCATGTAGTTGG + Intronic
1094505286 12:31055981-31056003 CCCCGTCTGCCTACTGCAGTTGG - Intergenic
1095940078 12:47720925-47720947 CCCAGGGTGCCTCCTGCAGGAGG + Intronic
1097794136 12:63844314-63844336 CCCTTCCTGCCTCCAGCTGTCGG - Exonic
1100751188 12:97699670-97699692 CCCCTCGTTCCTCTTTCAGTGGG - Intergenic
1101325668 12:103713413-103713435 CCCCAGGTGTGTCCTGCAGTAGG + Intronic
1103856461 12:123973559-123973581 CCCCTCGGGCCTCGGGCGGTCGG + Exonic
1104818092 12:131660116-131660138 CACCTGGAGGCTCCTGCAGTTGG - Intergenic
1106377377 13:29202964-29202986 ACCCCCGTGCCTCCTGTACTGGG - Intronic
1107120380 13:36789315-36789337 CCCCTCGACACTGCTGCAGTGGG + Intergenic
1110853984 13:80277395-80277417 CCCCTCTGGCTTCTTGCAGTGGG - Intergenic
1114549511 14:23524939-23524961 CCCCCAGTGCCTCCTCCGGTTGG + Exonic
1114764114 14:25350890-25350912 CCTCTCGTTCCTCCTGCCCTTGG + Intergenic
1116889663 14:50255779-50255801 CCCCTCGAGCCTCCCAAAGTGGG - Intronic
1120275557 14:82369228-82369250 CCCCTGGTGTCACCTGCATTTGG - Intergenic
1121137370 14:91510586-91510608 CCCCTCGTGCATCCTGGAGCGGG - Intergenic
1125516628 15:40324388-40324410 CCGGTCGCGCCGCCTGCAGTGGG - Intergenic
1127287377 15:57543552-57543574 CCCCTCGTGCCATCTGCTCTGGG - Intronic
1131312555 15:91304203-91304225 CCTCTCTCTCCTCCTGCAGTAGG - Intergenic
1133353354 16:5117519-5117541 CCATTCGTGGCTCCTGCGGTGGG - Intergenic
1134206621 16:12243388-12243410 CACCTGATGTCTCCTGCAGTTGG + Intronic
1136062771 16:27737969-27737991 CCCCTTGTTCCTCCTCCCGTTGG - Intronic
1138348470 16:56334053-56334075 CCCCTGCTACCTCCTGCTGTGGG - Intronic
1139264384 16:65625416-65625438 CCCCTCCTTCCTCCTACAGAGGG + Intergenic
1141624269 16:85253166-85253188 CTCCTCCTGCCTCCTCCCGTGGG - Intergenic
1142881581 17:2885996-2886018 CCCCTGGGGCCTCCTGCTCTGGG + Intronic
1149929885 17:60740876-60740898 CCCCTCGAGCCTCTGGCAGTGGG - Intronic
1150446179 17:65228438-65228460 GCCCGCGTGCTCCCTGCAGTTGG + Intergenic
1157554835 18:48606631-48606653 CCTGTCGTCCCTCCTGGAGTGGG - Intronic
1158282232 18:55840642-55840664 CACCTAGTGCCTCCTGCACCAGG + Intergenic
1158352666 18:56578784-56578806 CCCCTTGTGCTTCCCGCAGGAGG + Intergenic
1158962585 18:62598611-62598633 TCCCTCGTGCCTCCCCCAGTCGG + Intergenic
1159356685 18:67345524-67345546 CACCACTTGCCTCCTGCTGTGGG - Intergenic
1159960890 18:74555227-74555249 CCCCTCCTTCCTCCTGCTGCAGG + Intronic
1160910485 19:1471666-1471688 CCCCACGTGCCTTCTCCAGGAGG + Exonic
1161014769 19:1978214-1978236 CCCCTCCTGCCTCCTGCCTCGGG + Intronic
1162426855 19:10602386-10602408 CCCCGCGCGCCTCCTCCAATGGG - Intergenic
1162433504 19:10643242-10643264 CCCCTCATGCCTCCTGCTCTGGG + Intronic
1163400467 19:17089019-17089041 TCCCTCCTGTCACCTGCAGTGGG + Intronic
1163821715 19:19499862-19499884 CCCCAGGTCCCTCCTGCAGCTGG - Intronic
1165696674 19:37906427-37906449 ACCCTCGGGCCTCCTGCACGTGG + Intronic
1166855802 19:45782160-45782182 ACCCTCGGGGCTCCTGCAGATGG - Intronic
1166996188 19:46720686-46720708 CTCCTCGTGCTTCTTGCGGTGGG + Exonic
1167435101 19:49474605-49474627 CCCCTCATGCCTCCTGTCGCCGG - Exonic
1202695036 1_KI270712v1_random:117460-117482 CACCTGGTGTCTCCAGCAGTGGG + Intergenic
927705006 2:25291422-25291444 CCCCTGGCCCCTCCTGGAGTGGG - Intronic
928278161 2:29921025-29921047 CCTCTCCTGCCCCCCGCAGTCGG + Exonic
931178286 2:59875179-59875201 GCCCTCTTGCCTGCTGCAGAAGG + Intergenic
935722781 2:105994410-105994432 CCCCTCGTGGCTTCTGGAATGGG + Intergenic
935747495 2:106201508-106201530 CCCCACGTTTCTCCTGGAGTGGG - Intergenic
937488082 2:122336572-122336594 CCCCACCTGCCTCCTGGAGGTGG + Intergenic
937847818 2:126601110-126601132 CCCCTCCTGCATCTTGCAGAGGG + Intergenic
940095767 2:149972158-149972180 CCCCTTGGGCCTCCTGCCTTGGG - Intergenic
942812325 2:180013787-180013809 CCCCATATGCCACCTGCAGTGGG + Intergenic
944653944 2:201859080-201859102 CTGCGCGGGCCTCCTGCAGTGGG + Intronic
944861076 2:203816565-203816587 CCCCTCTTGACTCCTCCAATGGG - Intergenic
945172417 2:207010890-207010912 CACCTCCTGCCTCCTGCTGTGGG + Intergenic
946756605 2:222953768-222953790 CCCCCAGAGCCTCCTGCTGTGGG + Intergenic
947740098 2:232481043-232481065 GCCCCCGTCCCTCCTGCAGCAGG + Intronic
947874204 2:233457753-233457775 CCCCTGCTGCCCACTGCAGTCGG - Intronic
948463738 2:238142506-238142528 ACCCTCGTGCCGCCTGCTGGAGG + Intronic
948530315 2:238599878-238599900 CCCCACATGCCTCCTGCTGGGGG + Intergenic
1169184541 20:3603233-3603255 CCCCTCCTCCCTGCTACAGTGGG + Intronic
1170355182 20:15484660-15484682 CCCCTCATGCTTCCAGAAGTGGG - Intronic
1170706595 20:18749445-18749467 CCCCTCATGGCTTCTGCAGCAGG - Intronic
1172668095 20:36614511-36614533 CCCCTCCTGCCAACTGCAGAGGG - Intronic
1175941082 20:62537803-62537825 CCCGTCCTGCCTCCTGCTGGGGG - Intergenic
1176075014 20:63244453-63244475 CCCCTCGGGCCTCTTGCCTTTGG + Intronic
1176168257 20:63685683-63685705 CCCCACCTGCCTCCTGGAGGTGG - Intronic
1176305146 21:5119298-5119320 CCCATTGTGCCTCCTGTAGAAGG - Intronic
1179833527 21:44012777-44012799 GCCCTCGGGCCGGCTGCAGTTGG + Intronic
1179851909 21:44142732-44142754 CCCGTTGTGCCTCCTGTAGAAGG + Intronic
1180134757 21:45855240-45855262 CCTCTTTTCCCTCCTGCAGTCGG - Intronic
1183350584 22:37332600-37332622 CCCGTCCTGCTTCCTGCTGTGGG - Intergenic
1184253796 22:43275894-43275916 TCCCTCCTGCATCCTGCAGCCGG - Intronic
1184466201 22:44669887-44669909 CCCCTCCGGCCTTCTGCACTCGG + Intronic
1185038024 22:48489778-48489800 CCCCGCGGGCCTCCCGGAGTCGG + Intronic
950126848 3:10514864-10514886 CCCCTGGGGCCACCTGCAGGGGG - Intronic
950636607 3:14319892-14319914 TCCCGCTTGCCTCCTGCAGAGGG + Intergenic
952959049 3:38578363-38578385 TCCCTCGTCTCACCTGCAGTAGG - Intronic
953183231 3:40615701-40615723 CCCCGCGCGCCTGCTGCAGGGGG + Intergenic
954364389 3:50138524-50138546 CTCCTCATTCCCCCTGCAGTGGG + Intergenic
954403296 3:50330724-50330746 CCCCTTTTGCCCCTTGCAGTGGG - Exonic
958771886 3:98435218-98435240 CCCATCGTGCCTTCTGAGGTAGG + Intergenic
963044345 3:141091776-141091798 CCCCTGGTACCACCTGTAGTGGG - Intronic
963232729 3:142925232-142925254 CCCCTCCTGCTTCCAGCAGTGGG - Intergenic
966076373 3:175940565-175940587 CCAGTCCTGCATCCTGCAGTGGG - Intergenic
968911171 4:3477670-3477692 CCGCACGTGCCTCCTGCAGCTGG - Intronic
969718563 4:8880439-8880461 CCCTTCCTGCCTCCTCCAGTAGG - Intergenic
977377668 4:96227671-96227693 CCCCTCATGGTTCCGGCAGTTGG + Intergenic
977906554 4:102483554-102483576 CACCTAGTGCATCCTGCACTGGG - Intergenic
979289788 4:118966732-118966754 CCCCTAGTTCCTCCTGTATTGGG + Intronic
981914488 4:150018755-150018777 CCCTTTGTGCTTCCTGCAGGAGG + Intergenic
985706655 5:1405436-1405458 CACCTCGTGCCTGCTGGACTCGG + Intronic
986476335 5:8137450-8137472 CCCCTTGTTCCTCCTCCTGTGGG - Intergenic
986923400 5:12716813-12716835 GCCATGATGCCTCCTGCAGTGGG + Intergenic
988314252 5:29603203-29603225 CCCCTTGTGCTTCCTGCATGAGG - Intergenic
988479531 5:31618501-31618523 CTCCTGATGCCTCCTCCAGTCGG + Intergenic
988550160 5:32193584-32193606 CACCTCGGTCCTCCAGCAGTAGG + Intergenic
990202328 5:53390440-53390462 CCCCTCATGGCTCTGGCAGTTGG + Intergenic
991007468 5:61843960-61843982 CCCCTCATGCTTCCAGCAGAGGG + Intergenic
1002530531 5:179841847-179841869 CCTCTGCTGCCTCCAGCAGTGGG - Intronic
1008605030 6:53132025-53132047 TCCGTCGTGCCTCCAGAAGTTGG + Exonic
1008716594 6:54296148-54296170 CCTCTAGTGACTCCTGCAGAAGG - Intergenic
1008778664 6:55073326-55073348 CCCCTCATGATTCCTGCGGTTGG + Intergenic
1010927098 6:81755760-81755782 ACCCTACTGCCTCCTGCATTGGG + Intergenic
1014154977 6:118099740-118099762 CACCTTGTGCATCCTGCATTGGG + Intronic
1019104606 6:169657998-169658020 CCTCTGGTGCCTGTTGCAGTGGG - Intronic
1019174604 6:170153816-170153838 CCCTTTGTGCCTCCTGCAGATGG - Intergenic
1019661696 7:2227809-2227831 CCGGTCGTGCCCCCTGCAGGCGG - Intronic
1019825382 7:3280013-3280035 CCCCTAGTGCATCCTTCAGTGGG + Intergenic
1020062204 7:5160941-5160963 CCCCTCGTGCCTCCAGCAGGGGG + Intergenic
1020165940 7:5807736-5807758 CCCCTCGTGCCTCCAGCAGGGGG - Intergenic
1023378062 7:39577823-39577845 CACCTCGTGGATCCTGCACTGGG - Intronic
1024000669 7:45187390-45187412 CCCCTCCTGCCTCCTCAAATTGG - Intergenic
1024056906 7:45665773-45665795 CCCTCCCTCCCTCCTGCAGTGGG - Intronic
1028719346 7:94011806-94011828 CACCTAGTGGATCCTGCAGTGGG + Intergenic
1031528719 7:122851445-122851467 CCCCTCAGGCTTCCTGCTGTGGG - Intronic
1032791935 7:135248774-135248796 TCCCTCGTGGCTAGTGCAGTAGG + Intronic
1033726572 7:144124590-144124612 GCCCTGGGGCCTCCAGCAGTGGG - Intergenic
1035396771 7:158540090-158540112 CCCCACGTGGCTGCTGCAGCGGG + Intronic
1036386072 8:8283022-8283044 CCCCTTGTGCTTCTTGCAGCCGG + Intergenic
1037889397 8:22615575-22615597 CCCCTTGTGCCTCCTGGGTTGGG - Exonic
1040770146 8:50964297-50964319 TCCCTCGTGGGGCCTGCAGTTGG + Intergenic
1043223774 8:77699161-77699183 CCCCTGTTGTCTCATGCAGTTGG + Intergenic
1045595961 8:103656951-103656973 CCCCTCATGCCTCCAGCTGGGGG + Intronic
1046169209 8:110483484-110483506 CCCCTGCTGCCTCATGAAGTAGG - Intergenic
1048113538 8:131494115-131494137 CCCATCGGGACTCCTCCAGTAGG + Intergenic
1048766941 8:137854867-137854889 CCCCTCCTCCCTCCTGCCCTCGG + Intergenic
1049238260 8:141523605-141523627 CTCCTCCTGGCTCCTGCAGTGGG + Intergenic
1049878608 8:145045466-145045488 CCCTTCATGCTTCCAGCAGTGGG - Intergenic
1051164948 9:14251671-14251693 CCACTGGAGCCTCCTGCAGGAGG + Intronic
1051296455 9:15601069-15601091 CCCCTTGTGCCTCCTGGGGGAGG + Intronic
1057860024 9:98633721-98633743 CCCGCCCTGGCTCCTGCAGTTGG - Intronic
1059337035 9:113575439-113575461 CCCCTCTCTCCTCCTGCAGTGGG + Intronic
1059338581 9:113584250-113584272 GCCCTCGGGGCTCCTGCAGCAGG - Exonic
1060105374 9:120869794-120869816 CCTCTCCTGCCTCCTCCAGTGGG - Intronic
1061015639 9:127979742-127979764 CCCTGCGTGCCGCCTGCAGTAGG - Intronic
1061084379 9:128390592-128390614 CCCGTCCTGCTTCCTGCAGGAGG - Exonic
1062464080 9:136673560-136673582 CCCCTGGTGTCCCCTGCAGGGGG - Exonic
1185506553 X:635508-635530 CCCCTCCTCCCTCCGGCTGTGGG + Intronic
1186465135 X:9779119-9779141 CCCTCCGTGCCTCCTTCAGAAGG - Intronic
1186876652 X:13824482-13824504 TCCCTCCTGCCTCCAGCAGTTGG - Intronic
1192087930 X:68119865-68119887 CCCCTCATGCTTCCAGCAGGGGG + Intronic
1193510035 X:82388473-82388495 CGCCTTGTGCTTCCTGCATTAGG - Intergenic