ID: 1091558669

View in Genome Browser
Species Human (GRCh38)
Location 12:1594415-1594437
Sequence GCGCGGCGGCGCGGGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1055
Summary {0: 1, 1: 0, 2: 13, 3: 140, 4: 901}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558669_1091558686 28 Left 1091558669 12:1594415-1594437 CCGCTCCGCCCGCGCCGCCGCGC 0: 1
1: 0
2: 13
3: 140
4: 901
Right 1091558686 12:1594466-1594488 CTGCCGCCGCCGCTGCTCCGCGG 0: 1
1: 0
2: 5
3: 68
4: 452
1091558669_1091558687 29 Left 1091558669 12:1594415-1594437 CCGCTCCGCCCGCGCCGCCGCGC 0: 1
1: 0
2: 13
3: 140
4: 901
Right 1091558687 12:1594467-1594489 TGCCGCCGCCGCTGCTCCGCGGG 0: 1
1: 0
2: 3
3: 33
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558669 Original CRISPR GCGCGGCGGCGCGGGCGGAG CGG (reversed) Intronic