ID: 1091558670

View in Genome Browser
Species Human (GRCh38)
Location 12:1594420-1594442
Sequence CGTGGGCGCGGCGGCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 0, 2: 7, 3: 82, 4: 718}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558670_1091558687 24 Left 1091558670 12:1594420-1594442 CCGCCCGCGCCGCCGCGCCCACG 0: 1
1: 0
2: 7
3: 82
4: 718
Right 1091558687 12:1594467-1594489 TGCCGCCGCCGCTGCTCCGCGGG 0: 1
1: 0
2: 3
3: 33
4: 285
1091558670_1091558686 23 Left 1091558670 12:1594420-1594442 CCGCCCGCGCCGCCGCGCCCACG 0: 1
1: 0
2: 7
3: 82
4: 718
Right 1091558686 12:1594466-1594488 CTGCCGCCGCCGCTGCTCCGCGG 0: 1
1: 0
2: 5
3: 68
4: 452
1091558670_1091558689 28 Left 1091558670 12:1594420-1594442 CCGCCCGCGCCGCCGCGCCCACG 0: 1
1: 0
2: 7
3: 82
4: 718
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558670 Original CRISPR CGTGGGCGCGGCGGCGCGGG CGG (reversed) Intronic