ID: 1091558672

View in Genome Browser
Species Human (GRCh38)
Location 12:1594424-1594446
Sequence GGGGCGTGGGCGCGGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1453
Summary {0: 1, 1: 0, 2: 12, 3: 185, 4: 1255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558672_1091558691 27 Left 1091558672 12:1594424-1594446 CCGCGCCGCCGCGCCCACGCCCC 0: 1
1: 0
2: 12
3: 185
4: 1255
Right 1091558691 12:1594474-1594496 GCCGCTGCTCCGCGGGCCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 227
1091558672_1091558693 28 Left 1091558672 12:1594424-1594446 CCGCGCCGCCGCGCCCACGCCCC 0: 1
1: 0
2: 12
3: 185
4: 1255
Right 1091558693 12:1594475-1594497 CCGCTGCTCCGCGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 183
1091558672_1091558686 19 Left 1091558672 12:1594424-1594446 CCGCGCCGCCGCGCCCACGCCCC 0: 1
1: 0
2: 12
3: 185
4: 1255
Right 1091558686 12:1594466-1594488 CTGCCGCCGCCGCTGCTCCGCGG 0: 1
1: 0
2: 5
3: 68
4: 452
1091558672_1091558689 24 Left 1091558672 12:1594424-1594446 CCGCGCCGCCGCGCCCACGCCCC 0: 1
1: 0
2: 12
3: 185
4: 1255
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558672_1091558687 20 Left 1091558672 12:1594424-1594446 CCGCGCCGCCGCGCCCACGCCCC 0: 1
1: 0
2: 12
3: 185
4: 1255
Right 1091558687 12:1594467-1594489 TGCCGCCGCCGCTGCTCCGCGGG 0: 1
1: 0
2: 3
3: 33
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558672 Original CRISPR GGGGCGTGGGCGCGGCGGCG CGG (reversed) Intronic