ID: 1091558673

View in Genome Browser
Species Human (GRCh38)
Location 12:1594429-1594451
Sequence GGCAGGGGGCGTGGGCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1456
Summary {0: 1, 1: 1, 2: 13, 3: 160, 4: 1281}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558673_1091558687 15 Left 1091558673 12:1594429-1594451 CCGCCGCGCCCACGCCCCCTGCC 0: 1
1: 1
2: 13
3: 160
4: 1281
Right 1091558687 12:1594467-1594489 TGCCGCCGCCGCTGCTCCGCGGG 0: 1
1: 0
2: 3
3: 33
4: 285
1091558673_1091558686 14 Left 1091558673 12:1594429-1594451 CCGCCGCGCCCACGCCCCCTGCC 0: 1
1: 1
2: 13
3: 160
4: 1281
Right 1091558686 12:1594466-1594488 CTGCCGCCGCCGCTGCTCCGCGG 0: 1
1: 0
2: 5
3: 68
4: 452
1091558673_1091558689 19 Left 1091558673 12:1594429-1594451 CCGCCGCGCCCACGCCCCCTGCC 0: 1
1: 1
2: 13
3: 160
4: 1281
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558673_1091558691 22 Left 1091558673 12:1594429-1594451 CCGCCGCGCCCACGCCCCCTGCC 0: 1
1: 1
2: 13
3: 160
4: 1281
Right 1091558691 12:1594474-1594496 GCCGCTGCTCCGCGGGCCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 227
1091558673_1091558694 26 Left 1091558673 12:1594429-1594451 CCGCCGCGCCCACGCCCCCTGCC 0: 1
1: 1
2: 13
3: 160
4: 1281
Right 1091558694 12:1594478-1594500 CTGCTCCGCGGGCCGGCGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 233
1091558673_1091558693 23 Left 1091558673 12:1594429-1594451 CCGCCGCGCCCACGCCCCCTGCC 0: 1
1: 1
2: 13
3: 160
4: 1281
Right 1091558693 12:1594475-1594497 CCGCTGCTCCGCGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558673 Original CRISPR GGCAGGGGGCGTGGGCGCGG CGG (reversed) Intronic