ID: 1091558674

View in Genome Browser
Species Human (GRCh38)
Location 12:1594432-1594454
Sequence TGCGGCAGGGGGCGTGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 712}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558674_1091558697 29 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558697 12:1594484-1594506 CGCGGGCCGGCGGGCGGCGAGGG 0: 1
1: 0
2: 5
3: 85
4: 528
1091558674_1091558689 16 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558674_1091558694 23 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558694 12:1594478-1594500 CTGCTCCGCGGGCCGGCGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 233
1091558674_1091558696 28 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558696 12:1594483-1594505 CCGCGGGCCGGCGGGCGGCGAGG 0: 2
1: 1
2: 17
3: 141
4: 767
1091558674_1091558693 20 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558693 12:1594475-1594497 CCGCTGCTCCGCGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 183
1091558674_1091558698 30 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558674_1091558691 19 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558691 12:1594474-1594496 GCCGCTGCTCCGCGGGCCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 227
1091558674_1091558686 11 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558686 12:1594466-1594488 CTGCCGCCGCCGCTGCTCCGCGG 0: 1
1: 0
2: 5
3: 68
4: 452
1091558674_1091558687 12 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558687 12:1594467-1594489 TGCCGCCGCCGCTGCTCCGCGGG 0: 1
1: 0
2: 3
3: 33
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558674 Original CRISPR TGCGGCAGGGGGCGTGGGCG CGG (reversed) Intronic