ID: 1091558678

View in Genome Browser
Species Human (GRCh38)
Location 12:1594444-1594466
Sequence GGAGGCGGAGGATGCGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2297
Summary {0: 1, 1: 1, 2: 29, 3: 215, 4: 2051}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558678_1091558703 27 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558703 12:1594494-1594516 CGGGCGGCGAGGGGGCCCCGGGG 0: 1
1: 0
2: 8
3: 51
4: 435
1091558678_1091558702 26 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558702 12:1594493-1594515 GCGGGCGGCGAGGGGGCCCCGGG 0: 1
1: 0
2: 9
3: 84
4: 611
1091558678_1091558691 7 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558691 12:1594474-1594496 GCCGCTGCTCCGCGGGCCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 227
1091558678_1091558697 17 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558697 12:1594484-1594506 CGCGGGCCGGCGGGCGGCGAGGG 0: 1
1: 0
2: 5
3: 85
4: 528
1091558678_1091558689 4 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558678_1091558687 0 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558687 12:1594467-1594489 TGCCGCCGCCGCTGCTCCGCGGG 0: 1
1: 0
2: 3
3: 33
4: 285
1091558678_1091558698 18 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558678_1091558699 19 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558699 12:1594486-1594508 CGGGCCGGCGGGCGGCGAGGGGG 0: 1
1: 0
2: 16
3: 119
4: 843
1091558678_1091558686 -1 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558686 12:1594466-1594488 CTGCCGCCGCCGCTGCTCCGCGG 0: 1
1: 0
2: 5
3: 68
4: 452
1091558678_1091558704 28 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558704 12:1594495-1594517 GGGCGGCGAGGGGGCCCCGGGGG 0: 1
1: 1
2: 9
3: 94
4: 661
1091558678_1091558701 25 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558701 12:1594492-1594514 GGCGGGCGGCGAGGGGGCCCCGG 0: 1
1: 0
2: 11
3: 109
4: 939
1091558678_1091558696 16 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558696 12:1594483-1594505 CCGCGGGCCGGCGGGCGGCGAGG 0: 2
1: 1
2: 17
3: 141
4: 767
1091558678_1091558694 11 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558694 12:1594478-1594500 CTGCTCCGCGGGCCGGCGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 233
1091558678_1091558693 8 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558693 12:1594475-1594497 CCGCTGCTCCGCGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558678 Original CRISPR GGAGGCGGAGGATGCGGCAG GGG (reversed) Intronic