ID: 1091558683

View in Genome Browser
Species Human (GRCh38)
Location 12:1594459-1594481
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1888
Summary {0: 2, 1: 6, 2: 59, 3: 308, 4: 1513}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558683_1091558705 17 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558683_1091558708 26 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558708 12:1594508-1594530 GCCCCGGGGGCCGGGCGCACGGG 0: 1
1: 0
2: 3
3: 57
4: 473
1091558683_1091558698 3 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558683_1091558691 -8 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558691 12:1594474-1594496 GCCGCTGCTCCGCGGGCCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 227
1091558683_1091558696 1 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558696 12:1594483-1594505 CCGCGGGCCGGCGGGCGGCGAGG 0: 2
1: 1
2: 17
3: 141
4: 767
1091558683_1091558699 4 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558699 12:1594486-1594508 CGGGCCGGCGGGCGGCGAGGGGG 0: 1
1: 0
2: 16
3: 119
4: 843
1091558683_1091558706 18 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558683_1091558707 25 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558707 12:1594507-1594529 GGCCCCGGGGGCCGGGCGCACGG 0: 1
1: 0
2: 1
3: 60
4: 564
1091558683_1091558702 11 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558702 12:1594493-1594515 GCGGGCGGCGAGGGGGCCCCGGG 0: 1
1: 0
2: 9
3: 84
4: 611
1091558683_1091558704 13 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558704 12:1594495-1594517 GGGCGGCGAGGGGGCCCCGGGGG 0: 1
1: 1
2: 9
3: 94
4: 661
1091558683_1091558697 2 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558697 12:1594484-1594506 CGCGGGCCGGCGGGCGGCGAGGG 0: 1
1: 0
2: 5
3: 85
4: 528
1091558683_1091558694 -4 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558694 12:1594478-1594500 CTGCTCCGCGGGCCGGCGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 233
1091558683_1091558693 -7 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558693 12:1594475-1594497 CCGCTGCTCCGCGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 183
1091558683_1091558701 10 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558701 12:1594492-1594514 GGCGGGCGGCGAGGGGGCCCCGG 0: 1
1: 0
2: 11
3: 109
4: 939
1091558683_1091558703 12 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558703 12:1594494-1594516 CGGGCGGCGAGGGGGCCCCGGGG 0: 1
1: 0
2: 8
3: 51
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558683 Original CRISPR GCAGCGGCGGCGGCAGGAGG CGG (reversed) Intronic