ID: 1091558689

View in Genome Browser
Species Human (GRCh38)
Location 12:1594471-1594493
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 274}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558682_1091558689 -8 Left 1091558682 12:1594456-1594478 CCTCCGCCTCCTGCCGCCGCCGC 0: 1
1: 7
2: 66
3: 331
4: 1603
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558679_1091558689 3 Left 1091558679 12:1594445-1594467 CCCTGCCGCATCCTCCGCCTCCT 0: 1
1: 0
2: 5
3: 86
4: 1070
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558675_1091558689 11 Left 1091558675 12:1594437-1594459 CCCACGCCCCCTGCCGCATCCTC 0: 1
1: 0
2: 1
3: 27
4: 414
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558681_1091558689 -2 Left 1091558681 12:1594450-1594472 CCGCATCCTCCGCCTCCTGCCGC 0: 1
1: 1
2: 7
3: 160
4: 1581
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558673_1091558689 19 Left 1091558673 12:1594429-1594451 CCGCCGCGCCCACGCCCCCTGCC 0: 1
1: 1
2: 13
3: 160
4: 1281
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558670_1091558689 28 Left 1091558670 12:1594420-1594442 CCGCCCGCGCCGCCGCGCCCACG 0: 1
1: 0
2: 7
3: 82
4: 718
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558676_1091558689 10 Left 1091558676 12:1594438-1594460 CCACGCCCCCTGCCGCATCCTCC 0: 1
1: 0
2: 3
3: 87
4: 1010
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558677_1091558689 5 Left 1091558677 12:1594443-1594465 CCCCCTGCCGCATCCTCCGCCTC 0: 1
1: 0
2: 7
3: 115
4: 1153
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558680_1091558689 2 Left 1091558680 12:1594446-1594468 CCTGCCGCATCCTCCGCCTCCTG 0: 1
1: 0
2: 33
3: 547
4: 2432
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558672_1091558689 24 Left 1091558672 12:1594424-1594446 CCGCGCCGCCGCGCCCACGCCCC 0: 1
1: 0
2: 12
3: 185
4: 1255
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558674_1091558689 16 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558678_1091558689 4 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274
1091558671_1091558689 25 Left 1091558671 12:1594423-1594445 CCCGCGCCGCCGCGCCCACGCCC 0: 1
1: 0
2: 18
3: 144
4: 1101
Right 1091558689 12:1594471-1594493 GCCGCCGCTGCTCCGCGGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type