ID: 1091558698

View in Genome Browser
Species Human (GRCh38)
Location 12:1594485-1594507
Sequence GCGGGCCGGCGGGCGGCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 1, 1: 0, 2: 14, 3: 103, 4: 733}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558679_1091558698 17 Left 1091558679 12:1594445-1594467 CCCTGCCGCATCCTCCGCCTCCT 0: 1
1: 0
2: 5
3: 86
4: 1070
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558684_1091558698 0 Left 1091558684 12:1594462-1594484 CCTCCTGCCGCCGCCGCTGCTCC 0: 2
1: 1
2: 34
3: 167
4: 1284
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558683_1091558698 3 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558677_1091558698 19 Left 1091558677 12:1594443-1594465 CCCCCTGCCGCATCCTCCGCCTC 0: 1
1: 0
2: 7
3: 115
4: 1153
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558685_1091558698 -3 Left 1091558685 12:1594465-1594487 CCTGCCGCCGCCGCTGCTCCGCG 0: 1
1: 0
2: 10
3: 87
4: 563
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558675_1091558698 25 Left 1091558675 12:1594437-1594459 CCCACGCCCCCTGCCGCATCCTC 0: 1
1: 0
2: 1
3: 27
4: 414
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558674_1091558698 30 Left 1091558674 12:1594432-1594454 CCGCGCCCACGCCCCCTGCCGCA 0: 1
1: 0
2: 4
3: 56
4: 712
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558690_1091558698 -10 Left 1091558690 12:1594472-1594494 CCGCCGCTGCTCCGCGGGCCGGC 0: 1
1: 0
2: 2
3: 17
4: 208
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558681_1091558698 12 Left 1091558681 12:1594450-1594472 CCGCATCCTCCGCCTCCTGCCGC 0: 1
1: 1
2: 7
3: 160
4: 1581
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558680_1091558698 16 Left 1091558680 12:1594446-1594468 CCTGCCGCATCCTCCGCCTCCTG 0: 1
1: 0
2: 33
3: 547
4: 2432
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558682_1091558698 6 Left 1091558682 12:1594456-1594478 CCTCCGCCTCCTGCCGCCGCCGC 0: 1
1: 7
2: 66
3: 331
4: 1603
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558688_1091558698 -7 Left 1091558688 12:1594469-1594491 CCGCCGCCGCTGCTCCGCGGGCC 0: 1
1: 0
2: 3
3: 58
4: 413
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558678_1091558698 18 Left 1091558678 12:1594444-1594466 CCCCTGCCGCATCCTCCGCCTCC 0: 1
1: 1
2: 29
3: 215
4: 2051
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733
1091558676_1091558698 24 Left 1091558676 12:1594438-1594460 CCACGCCCCCTGCCGCATCCTCC 0: 1
1: 0
2: 3
3: 87
4: 1010
Right 1091558698 12:1594485-1594507 GCGGGCCGGCGGGCGGCGAGGGG 0: 1
1: 0
2: 14
3: 103
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558698 Original CRISPR GCGGGCCGGCGGGCGGCGAG GGG Intronic