ID: 1091558705

View in Genome Browser
Species Human (GRCh38)
Location 12:1594499-1594521
Sequence GGCGAGGGGGCCCCGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1002
Summary {0: 1, 1: 0, 2: 7, 3: 99, 4: 895}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558695_1091558705 -7 Left 1091558695 12:1594483-1594505 CCGCGGGCCGGCGGGCGGCGAGG 0: 1
1: 1
2: 7
3: 47
4: 363
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558683_1091558705 17 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558692_1091558705 1 Left 1091558692 12:1594475-1594497 CCGCTGCTCCGCGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558681_1091558705 26 Left 1091558681 12:1594450-1594472 CCGCATCCTCCGCCTCCTGCCGC 0: 1
1: 1
2: 7
3: 160
4: 1581
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558680_1091558705 30 Left 1091558680 12:1594446-1594468 CCTGCCGCATCCTCCGCCTCCTG 0: 1
1: 0
2: 33
3: 547
4: 2432
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558684_1091558705 14 Left 1091558684 12:1594462-1594484 CCTCCTGCCGCCGCCGCTGCTCC 0: 2
1: 1
2: 34
3: 167
4: 1284
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558688_1091558705 7 Left 1091558688 12:1594469-1594491 CCGCCGCCGCTGCTCCGCGGGCC 0: 1
1: 0
2: 3
3: 58
4: 413
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558690_1091558705 4 Left 1091558690 12:1594472-1594494 CCGCCGCTGCTCCGCGGGCCGGC 0: 1
1: 0
2: 2
3: 17
4: 208
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558682_1091558705 20 Left 1091558682 12:1594456-1594478 CCTCCGCCTCCTGCCGCCGCCGC 0: 1
1: 7
2: 66
3: 331
4: 1603
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895
1091558685_1091558705 11 Left 1091558685 12:1594465-1594487 CCTGCCGCCGCCGCTGCTCCGCG 0: 1
1: 0
2: 10
3: 87
4: 563
Right 1091558705 12:1594499-1594521 GGCGAGGGGGCCCCGGGGGCCGG 0: 1
1: 0
2: 7
3: 99
4: 895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558705 Original CRISPR GGCGAGGGGGCCCCGGGGGC CGG Intronic