ID: 1091558706

View in Genome Browser
Species Human (GRCh38)
Location 12:1594500-1594522
Sequence GCGAGGGGGCCCCGGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 774}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091558681_1091558706 27 Left 1091558681 12:1594450-1594472 CCGCATCCTCCGCCTCCTGCCGC 0: 1
1: 1
2: 7
3: 160
4: 1581
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558690_1091558706 5 Left 1091558690 12:1594472-1594494 CCGCCGCTGCTCCGCGGGCCGGC 0: 1
1: 0
2: 2
3: 17
4: 208
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558685_1091558706 12 Left 1091558685 12:1594465-1594487 CCTGCCGCCGCCGCTGCTCCGCG 0: 1
1: 0
2: 10
3: 87
4: 563
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558692_1091558706 2 Left 1091558692 12:1594475-1594497 CCGCTGCTCCGCGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558683_1091558706 18 Left 1091558683 12:1594459-1594481 CCGCCTCCTGCCGCCGCCGCTGC 0: 2
1: 6
2: 59
3: 308
4: 1513
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558682_1091558706 21 Left 1091558682 12:1594456-1594478 CCTCCGCCTCCTGCCGCCGCCGC 0: 1
1: 7
2: 66
3: 331
4: 1603
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558695_1091558706 -6 Left 1091558695 12:1594483-1594505 CCGCGGGCCGGCGGGCGGCGAGG 0: 1
1: 1
2: 7
3: 47
4: 363
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558688_1091558706 8 Left 1091558688 12:1594469-1594491 CCGCCGCCGCTGCTCCGCGGGCC 0: 1
1: 0
2: 3
3: 58
4: 413
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774
1091558684_1091558706 15 Left 1091558684 12:1594462-1594484 CCTCCTGCCGCCGCCGCTGCTCC 0: 2
1: 1
2: 34
3: 167
4: 1284
Right 1091558706 12:1594500-1594522 GCGAGGGGGCCCCGGGGGCCGGG 0: 1
1: 0
2: 3
3: 71
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091558706 Original CRISPR GCGAGGGGGCCCCGGGGGCC GGG Intronic