ID: 1091558709 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:1594509-1594531 |
| Sequence | GCCCGTGCGCCCGGCCCCCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 423 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 36, 4: 385} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1091558709_1091558717 | -6 | Left | 1091558709 | 12:1594509-1594531 | CCCCGGGGGCCGGGCGCACGGGC | 0: 1 1: 0 2: 1 3: 36 4: 385 |
||
| Right | 1091558717 | 12:1594526-1594548 | ACGGGCTCCGGGCGCGGAGGAGG | 0: 1 1: 0 2: 3 3: 19 4: 233 |
||||
| 1091558709_1091558716 | -9 | Left | 1091558709 | 12:1594509-1594531 | CCCCGGGGGCCGGGCGCACGGGC | 0: 1 1: 0 2: 1 3: 36 4: 385 |
||
| Right | 1091558716 | 12:1594523-1594545 | CGCACGGGCTCCGGGCGCGGAGG | 0: 1 1: 0 2: 1 3: 23 4: 233 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1091558709 | Original CRISPR | GCCCGTGCGCCCGGCCCCCG GGG (reversed) | Intronic | ||