ID: 1091560227

View in Genome Browser
Species Human (GRCh38)
Location 12:1606543-1606565
Sequence AAGTTGGAACAGCTTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091560221_1091560227 -3 Left 1091560221 12:1606523-1606545 CCCTGTCCACATTTTCTCTAAAG 0: 1
1: 0
2: 3
3: 20
4: 269
Right 1091560227 12:1606543-1606565 AAGTTGGAACAGCTTGCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 182
1091560219_1091560227 30 Left 1091560219 12:1606490-1606512 CCTTGTGTGCAGGAAATTAAAGA 0: 1
1: 0
2: 1
3: 17
4: 246
Right 1091560227 12:1606543-1606565 AAGTTGGAACAGCTTGCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 182
1091560224_1091560227 -9 Left 1091560224 12:1606529-1606551 CCACATTTTCTCTAAAGTTGGAA 0: 1
1: 0
2: 0
3: 20
4: 334
Right 1091560227 12:1606543-1606565 AAGTTGGAACAGCTTGCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 182
1091560222_1091560227 -4 Left 1091560222 12:1606524-1606546 CCTGTCCACATTTTCTCTAAAGT 0: 1
1: 0
2: 1
3: 13
4: 246
Right 1091560227 12:1606543-1606565 AAGTTGGAACAGCTTGCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091560227 Original CRISPR AAGTTGGAACAGCTTGCCTG GGG Intronic
902774242 1:18664428-18664450 AAGAGGGAACACCATGCCTGGGG + Intronic
903866108 1:26399234-26399256 GCACTGGAACAGCTTGCCTGAGG - Intergenic
904602283 1:31680236-31680258 GAGTTTGAACAGGTTGCCTAAGG - Intronic
905236938 1:36556491-36556513 GAGATGAAATAGCTTGCCTGAGG + Intergenic
905239109 1:36571117-36571139 AGGTGGGAACAGCTGGGCTGAGG - Intergenic
905239160 1:36571323-36571345 AAGTGGGGACAGCTGGGCTGAGG - Intergenic
906590198 1:47017765-47017787 AAGGTGGGACAACTTGCCAGAGG - Intergenic
907787186 1:57624046-57624068 GAGGTGAAACAGCTTGCCTGGGG - Intronic
911025777 1:93434501-93434523 ATGATGGGACAGCCTGCCTGTGG - Intergenic
911271525 1:95807511-95807533 AAATTGGAACAGGCTGCCTTTGG - Intergenic
912580101 1:110713164-110713186 AAGTTTGCTCAGCATGCCTGAGG - Intergenic
916448642 1:164897175-164897197 GACTTGGAGCAGCTTGCATGAGG - Intronic
920566710 1:206980018-206980040 TCTTTGCAACAGCTTGCCTGGGG + Intergenic
920694154 1:208169114-208169136 AACATGGAACAGCTGGGCTGGGG + Intronic
921073805 1:211684009-211684031 ATGGTGGCACAGCTTGCTTGGGG - Intergenic
921795403 1:219337936-219337958 AAGATGAAACAGCTAGCATGTGG - Intergenic
922627283 1:227061436-227061458 AAGATGGATCAACTTGCCTAAGG + Intronic
923499853 1:234555540-234555562 AAGCTGGAGCAGCGTGCCTTAGG - Intergenic
1063274842 10:4554320-4554342 AAGTGGGTAAAGCTAGCCTGTGG - Intergenic
1065061037 10:21900836-21900858 AGGTTAGAACACTTTGCCTGTGG - Intronic
1067971541 10:50976118-50976140 ATTTTGGAACAGCATCCCTGTGG - Intergenic
1068685676 10:59867992-59868014 AAGGTGGTACAGCTTGTTTGTGG - Intronic
1071600182 10:86955180-86955202 TAGATGGGACACCTTGCCTGGGG + Intronic
1073951457 10:108814073-108814095 AAGTTGGAGTTGGTTGCCTGTGG - Intergenic
1074052414 10:109892217-109892239 AAGGTGAAACAGCTCCCCTGGGG - Intronic
1074342512 10:112647055-112647077 AAGGTTAAACAACTTGCCTGTGG - Intronic
1074448111 10:113537137-113537159 AAGTGGGAGCAGCTACCCTGGGG - Intergenic
1074605576 10:114961254-114961276 AAGTTGGACCAGGGTGCCAGTGG + Intronic
1075825009 10:125348396-125348418 AAATTGGCACAGCTTTTCTGGGG + Intergenic
1076009894 10:126979515-126979537 AAAAAGGAACAGCTTGCCTGGGG - Intronic
1078362605 11:10680702-10680724 AAGATGAAACAGCTTGCCCAAGG - Intronic
1078545705 11:12245653-12245675 AAGGTCAAACAGCTGGCCTGTGG - Intronic
1083452788 11:62757307-62757329 CAGCTGGAACTGCTTGCTTGTGG - Intergenic
1084013833 11:66367384-66367406 CAGATGGAACAGCTTCCCAGGGG + Intronic
1086314084 11:85571490-85571512 GAGTTGTAACTGCTTGCATGAGG - Intronic
1086880599 11:92149140-92149162 CAGTTGGAGGAGTTTGCCTGAGG + Intergenic
1089347188 11:117797755-117797777 AAATTCGAACAGCGTGCCAGGGG - Intronic
1091560227 12:1606543-1606565 AAGTTGGAACAGCTTGCCTGGGG + Intronic
1091694056 12:2616288-2616310 AAGCTGGAGCAGCTGGGCTGAGG - Intronic
1092769373 12:11882947-11882969 AGGTTGAAATAACTTGCCTGAGG - Intronic
1094235143 12:28155801-28155823 CATTTTGAACAGTTTGCCTGTGG + Intronic
1095104427 12:38214758-38214780 CAGTTGGAATAGTTTTCCTGGGG - Intergenic
1097923640 12:65104518-65104540 AAGGTTGAATAACTTGCCTGAGG - Intronic
1098600102 12:72320822-72320844 ATGCTTAAACAGCTTGCCTGAGG - Intronic
1100207578 12:92367326-92367348 AATTGGGAACAGCCTGCCAGGGG - Intergenic
1102056006 12:109897109-109897131 AAGGTGGCATGGCTTGCCTGAGG - Intergenic
1102769605 12:115463835-115463857 AAGTTGGAACAGCTGGAAGGAGG + Intergenic
1103222312 12:119256042-119256064 AAATTGGAGTAACTTGCCTGAGG + Intergenic
1103467926 12:121156774-121156796 AAGTTGGGAAAGATTGTCTGGGG - Intronic
1105549987 13:21384684-21384706 AAATTTGACCAGCTTGACTGGGG + Intronic
1105594702 13:21826472-21826494 AATTTGGAAAAGCCTACCTGAGG + Intergenic
1105994089 13:25653789-25653811 AAGTTGGAACAGATTTCATTTGG - Intronic
1107496972 13:40936138-40936160 AGGTTGCAACAGCTTGCATAAGG + Intronic
1107671475 13:42750626-42750648 AAGTTGGAAAAACTTGCAAGTGG + Intergenic
1108854397 13:54775335-54775357 ATGATGGAACATCCTGCCTGTGG - Intergenic
1109687809 13:65843992-65844014 ACGTTGGGACAACCTGCCTGTGG + Intergenic
1112026364 13:95414817-95414839 AAAATGGAACAACTTGACTGGGG - Intergenic
1115080082 14:29440062-29440084 AAGTTTAAACAGCTTGCCCAGGG + Intergenic
1115760311 14:36574363-36574385 AAGATAGAACTGCTTTCCTGGGG - Intergenic
1115964684 14:38874602-38874624 AAGTTGGAACAACTTGGCATAGG + Intergenic
1116282711 14:42928962-42928984 AAGTGGGCACAGCTAGGCTGGGG + Intergenic
1119322199 14:73738875-73738897 ATGTAGGAACAGGTTGCCAGTGG + Exonic
1119416593 14:74474493-74474515 AAGTTGCATCAGGTTGCCTCTGG - Intergenic
1122423070 14:101589592-101589614 AAGGTCGTACAGCTGGCCTGTGG + Intergenic
1122756744 14:103986761-103986783 AAATTGGAACATTTTCCCTGAGG + Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1127744445 15:61952208-61952230 AAGATGAAAGAGCTTGCCTTAGG - Intronic
1128699970 15:69796920-69796942 GAGGTACAACAGCTTGCCTGGGG - Intergenic
1132261978 15:100433804-100433826 AAGTGGGCAAAGCTTGCCTCAGG + Intronic
1134533089 16:15000358-15000380 AAGTTGGAATAGCTTGCTCGAGG + Intronic
1137339846 16:47590848-47590870 AAGCTGGAAAAGCTTTCATGGGG - Intronic
1139749960 16:69103833-69103855 AAGTTTGAAGAGATTGGCTGAGG - Intergenic
1139862944 16:70040370-70040392 AAGTTGGAATAGCTTGCTCGAGG - Intergenic
1140214328 16:72995258-72995280 AAGTTTGAACAGCTTGTTTATGG - Intronic
1140564825 16:76029668-76029690 AAGTAAGAACAGTTTTCCTGGGG + Intergenic
1141894791 16:86952502-86952524 CACTTGGCACAGCTGGCCTGGGG - Intergenic
1143601942 17:7952763-7952785 AAGTGGGGACTGCTTGACTGTGG - Intergenic
1143943500 17:10568334-10568356 AAGTTGGAAAAGCTAGCATTTGG + Intergenic
1144396122 17:14844839-14844861 AAGCTGGAGCAGCTTGACTGGGG + Intergenic
1144798825 17:17911600-17911622 AAGTTGGATCTGATTGCCTCTGG - Intronic
1145385528 17:22409281-22409303 AAGCTGACACAGCTTGCCTGAGG + Intergenic
1147693811 17:42336195-42336217 ATGTTGCACCAGCTTGCCTTAGG - Intronic
1147925360 17:43942396-43942418 AAGTGGGCTCAGCCTGCCTGGGG - Intronic
1150030035 17:61723403-61723425 AAGATGGCAGAGCTTGCCTTGGG - Intronic
1152184446 17:78845350-78845372 TAGTTGGGACCTCTTGCCTGTGG - Intergenic
1155304863 18:24469177-24469199 CAGTTGGGACAACTTGCCTTGGG - Intronic
1156174197 18:34522802-34522824 AAGATGGACCAGCTTGCCAATGG + Intronic
1157268626 18:46251216-46251238 CAGTTGGAACAGTGTGCATGAGG + Intronic
1157562243 18:48656576-48656598 AAATGGAAACAGCTTGCTTGTGG - Intronic
1157581014 18:48774196-48774218 AAGTAGGAAAAGCTGGCCTTTGG - Intronic
1160451603 18:78970183-78970205 GAGTTGGAATAGCTTGTCCGAGG - Intergenic
1162317194 19:9946715-9946737 AAGGTGAAGCAACTTGCCTGAGG + Intergenic
1165461368 19:35945950-35945972 AAGTTGGACCAGCTGGGCTAGGG + Intergenic
1167762918 19:51460671-51460693 AAGTTGGAGCAGCAGCCCTGAGG + Intergenic
926963384 2:18383988-18384010 AAGTTGGTACAGCTTTCTAGAGG - Intergenic
931038200 2:58266732-58266754 AAGTTGGATCACCTTGTTTGTGG - Intergenic
931219098 2:60273208-60273230 AAGATTCAACAGCTGGCCTGTGG - Intergenic
931911738 2:66906880-66906902 AAGTTTTAACAGCTTGATTGAGG + Intergenic
935236248 2:101140679-101140701 GAGTTGGAAGAGGTTGCCTTTGG - Intronic
945656532 2:212631278-212631300 AAGTTGGAACAGCAAGTCTTGGG + Intergenic
948905017 2:240975665-240975687 CATTTGTAACAGCTTCCCTGGGG + Intronic
1170465754 20:16621149-16621171 AAGATGGAACAGGTAGCCTGAGG - Intergenic
1170555646 20:17512842-17512864 AGGTTTAAATAGCTTGCCTGAGG - Intronic
1172225625 20:33303443-33303465 ATGAGGGAATAGCTTGCCTGAGG - Intronic
1173462497 20:43254499-43254521 AAGTTTGAAAAGGTTGGCTGTGG - Intergenic
1175763303 20:61575830-61575852 AGGTAGGCACAGCTTCCCTGGGG + Intronic
1177037384 21:16060716-16060738 ACGTTGGAACAACCTGCCTAGGG - Intergenic
1177055927 21:16300823-16300845 TAGATGGAACAGCTTGTGTGAGG - Intergenic
1177875365 21:26625745-26625767 ACGTTGGGACAGCCTGCCTGTGG - Intergenic
1181908637 22:26220144-26220166 AAGGTGGAGCCGCTTGCCTGGGG - Intronic
1182562919 22:31175552-31175574 AAATTGGCACATCTTCCCTGGGG + Intronic
1183065222 22:35358048-35358070 AAGTTAGAGTAGCTTGTCTGAGG - Intergenic
1183551010 22:38485387-38485409 AAGTTGGAACAGGTTTCCTCGGG - Exonic
950834561 3:15906608-15906630 ATGTTGTACCAGCATGCCTGTGG + Intergenic
951683244 3:25316480-25316502 AATTTGGAAAAGCATGCCTGGGG + Intronic
952311443 3:32194055-32194077 CATTTGTAACAGGTTGCCTGGGG + Intergenic
956690699 3:71875539-71875561 AAGTTGCTGCAGCCTGCCTGGGG - Intergenic
956711628 3:72043304-72043326 AAGATCAAACAGCTTGCCTCAGG + Intergenic
960266513 3:115626378-115626400 AAGTTGGAATACATTGCCAGTGG + Intronic
962297543 3:134205464-134205486 AAGATTGAATAGCTTTCCTGTGG - Intronic
963642886 3:147880442-147880464 AAGATTGAACATCTTCCCTGTGG + Intergenic
964294006 3:155213540-155213562 GGCTTGGAACAGCTTACCTGAGG - Intergenic
964519869 3:157553511-157553533 TAGTTTGAAAAGCCTGCCTGGGG - Intronic
965218113 3:165891631-165891653 GAGTTGGAAACGCTGGCCTGTGG - Intergenic
965388299 3:168072403-168072425 AAGATTCAACAACTTGCCTGAGG + Intronic
965852063 3:173039953-173039975 AAGGTGGATCAGATTCCCTGAGG - Intronic
966565576 3:181377106-181377128 CAGCTGTAACAGCTTGCTTGAGG - Intergenic
967729900 3:192897661-192897683 GATTTGGAACTGGTTGCCTGTGG - Intronic
968628826 4:1639727-1639749 TTGTTGGATCAGCTTTCCTGAGG - Intronic
971910000 4:32783639-32783661 GAGTTGGAACAGAATGACTGGGG - Intergenic
972337697 4:38122329-38122351 AAGTTAGAATTGCTTGGCTGGGG + Intronic
972369644 4:38410579-38410601 AAATTGGAATTGCTTCCCTGGGG + Intergenic
972966422 4:44516412-44516434 GAATTGGAAAAGCTGGCCTGAGG + Intergenic
973895616 4:55409791-55409813 AAGTTGGAACAGACTGCTAGAGG - Intronic
974178937 4:58360302-58360324 ATGATGGGACAGCCTGCCTGCGG - Intergenic
974329771 4:60463664-60463686 AAGTAGGGTCAGCTTCCCTGTGG + Intergenic
975255372 4:72229444-72229466 AAGATGTAACAGCATGCCAGTGG - Intergenic
978799039 4:112737554-112737576 CAGCTGGAGCAGCTTGACTGGGG + Intergenic
980290680 4:130845234-130845256 AAGTTGGAACATGTGGTCTGTGG + Intergenic
981566531 4:146107394-146107416 AAGTTGGAATGACTTGCCCGGGG + Intergenic
984169412 4:176343150-176343172 AGGATGGGACAACTTGCCTGTGG - Intergenic
984559841 4:181255290-181255312 AATGTTGATCAGCTTGCCTGAGG + Intergenic
984679500 4:182590909-182590931 AAGCTGGCATAGCTTTCCTGAGG - Intronic
986329320 5:6705852-6705874 AAGTTTAATCAGTTTGCCTGAGG + Intergenic
987054069 5:14174378-14174400 AACTTGGAGCAGCTTTGCTGGGG - Intronic
987638887 5:20585225-20585247 AGGTTGGCAGAGCTTCCCTGAGG + Intergenic
989730437 5:44641684-44641706 ACATTGGAACAGCCTGCCTGTGG - Intergenic
992595218 5:78339828-78339850 AAGTTTCAACAGTTTCCCTGAGG - Intergenic
993772407 5:91945959-91945981 TAGTTGGGACAGCTTGAATGGGG + Intergenic
993833057 5:92783209-92783231 AAGGTAGAATACCTTGCCTGTGG + Intergenic
994283501 5:97936092-97936114 ATTTTGAAAGAGCTTGCCTGTGG + Intergenic
998448185 5:142214425-142214447 AAGGTGAAGCAGCTTGCCCGAGG + Intergenic
1000259927 5:159578034-159578056 TGGAGGGAACAGCTTGCCTGAGG + Intergenic
1000787050 5:165558336-165558358 ATGGTTGAAAAGCTTGCCTGGGG + Intergenic
1000854207 5:166379199-166379221 ATGTTGGAACAACCTGCCTGTGG - Intergenic
1003742023 6:8951587-8951609 AAGTTTGCACAGCTAGTCTGTGG - Intergenic
1008888432 6:56457028-56457050 AAGTTTGAAAAGCTCACCTGGGG + Intergenic
1011347398 6:86386857-86386879 AAGATGGAATAGATTGCCTTGGG - Intergenic
1011528004 6:88287576-88287598 AGCTTGGGACAACTTGCCTGTGG - Intergenic
1014105902 6:117560569-117560591 AAGTTAGCACAGCTTGTCTGTGG - Exonic
1014187938 6:118457123-118457145 AAGTTGGAACAGCTTGAAAGAGG - Intergenic
1015326634 6:131931084-131931106 ACCTTGGAACAGCTTATCTGAGG - Intergenic
1017564144 6:155666264-155666286 AAGTTTGAACAGCTTCACTTGGG + Intergenic
1018560832 6:165099462-165099484 AAGATTGAACATCTTCCCTGTGG - Intergenic
1019446015 7:1071773-1071795 AAGGTGGAATGGCATGCCTGCGG + Intronic
1022673184 7:32475144-32475166 AAATTGGAACAGCTTGCCTCAGG - Intergenic
1023528085 7:41126112-41126134 AATTGGGAAGAGATTGCCTGGGG + Intergenic
1024359264 7:48451228-48451250 AAGGTGGAGCAGATTACCTGAGG - Intronic
1024540930 7:50474488-50474510 AAGGTGGCAGGGCTTGCCTGAGG - Intronic
1026384365 7:69831424-69831446 CAGTTGGAACAGCTTCTCAGTGG + Intronic
1028161718 7:87493259-87493281 AGTTTGGAAAACCTTGCCTGTGG - Intergenic
1030066522 7:105663698-105663720 AAGTCAGAAAAGGTTGCCTGTGG - Intronic
1032884109 7:136119410-136119432 CAGCTTGCACAGCTTGCCTGTGG + Intergenic
1034165409 7:149021602-149021624 AACTTAGAACAGCTGGCATGAGG - Intronic
1037767071 8:21778656-21778678 AAGTGGGAAGAGATTGCTTGAGG + Intronic
1040607788 8:48951675-48951697 AAGTGAGAACATCTTGCCTTTGG - Intergenic
1042198719 8:66258557-66258579 CAGTTTGAACAGCTTCCCTTAGG + Intergenic
1043340427 8:79230979-79231001 AAGTTGGAAACGCTTATCTGAGG + Intergenic
1044043839 8:87404226-87404248 AAGTTGGAACAGCTTGTTTATGG + Intronic
1048057604 8:130883066-130883088 AGGGAGGAACAGCATGCCTGAGG - Intronic
1048342776 8:133553769-133553791 AAGGTGGCACAGGTTGCCTGTGG - Intronic
1048833966 8:138500685-138500707 AAGTCCGAGCAGCTTCCCTGGGG + Intergenic
1049241455 8:141539415-141539437 GGGTTGGGACAGCTTCCCTGAGG + Intergenic
1049365094 8:142233256-142233278 GAGCTGGCACAGCTTTCCTGGGG + Intronic
1052708015 9:32016426-32016448 TAGTTGGGACACCTTGGCTGTGG - Intergenic
1052778711 9:32758673-32758695 TGGTTGGAACAGCTTGACTGGGG + Intergenic
1053430108 9:38036518-38036540 ATGTTGCAAGAGCTTGGCTGAGG + Intronic
1058545750 9:106059260-106059282 ATATTGGAACAACCTGCCTGTGG - Intergenic
1059211685 9:112518085-112518107 TAGCTGGGACAGCTTGCATGTGG - Intronic
1059499375 9:114737975-114737997 AAATTGGAACTGCTTGAGTGTGG + Intergenic
1060113978 9:120926700-120926722 AAGTTGCAACAGGTGGCCTCTGG + Exonic
1060217054 9:121744745-121744767 GAGGTCAAACAGCTTGCCTGAGG - Intronic
1061281650 9:129601164-129601186 CATTTGGAAGAGCTTCCCTGAGG + Intergenic
1185830486 X:3297683-3297705 GAGTTTGAACAGCTTGCCTTTGG - Intergenic
1186590945 X:10929353-10929375 GAGTTTGAACCCCTTGCCTGAGG + Intergenic
1186748964 X:12601906-12601928 AAGTCTGAGCAGCTTGGCTGAGG - Intronic
1195199975 X:102539354-102539376 TAGTTGGTACAGCTTGCCTTGGG - Intergenic
1195403259 X:104484516-104484538 CAGTTGGACAAGCTTGCCTAAGG - Intergenic
1195859145 X:109362460-109362482 AAGTTTGCACAGCTTGCTAGTGG - Intergenic
1196034236 X:111126014-111126036 AAGTTATAACAACTTGCTTGAGG - Intronic
1196101352 X:111850483-111850505 AAGTTGGCTCAGCCTGCTTGGGG + Intronic
1196426211 X:115572153-115572175 AAGCTGGAACACCTTGTTTGAGG - Intronic
1197669785 X:129263753-129263775 GAGTTGGCACAGGTAGCCTGAGG + Intergenic
1201247436 Y:12019203-12019225 GAGTTTGAACAGCTTGCCTTTGG + Intergenic
1201569527 Y:15399325-15399347 AAGCTGGAACAGCTGGGATGTGG - Intergenic