ID: 1091562899

View in Genome Browser
Species Human (GRCh38)
Location 12:1628499-1628521
Sequence CAATAACTACAGATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091562899_1091562901 1 Left 1091562899 12:1628499-1628521 CCTGGGGAAATCTGTAGTTATTG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1091562901 12:1628523-1628545 AAAGGCCTTTTCCTGCCTGTTGG 0: 1
1: 0
2: 1
3: 19
4: 212
1091562899_1091562902 2 Left 1091562899 12:1628499-1628521 CCTGGGGAAATCTGTAGTTATTG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1091562902 12:1628524-1628546 AAGGCCTTTTCCTGCCTGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091562899 Original CRISPR CAATAACTACAGATTTCCCC AGG (reversed) Intronic
902157507 1:14500454-14500476 CTATAACTATAAATTTCCCAAGG - Intergenic
903063544 1:20685908-20685930 CAACAACTCCAGCCTTCCCCGGG - Intronic
903073769 1:20745302-20745324 AAATAATTACATATTTCCCTAGG - Intronic
903172780 1:21564036-21564058 CAATGCCCACAGATTTCCCTGGG - Exonic
903467880 1:23564966-23564988 CAGTAACTACAGAATGCCCACGG + Intergenic
905263540 1:36735598-36735620 CCAGAACTCCAGATTTGCCCAGG - Intergenic
907637865 1:56154809-56154831 CTATAACTACAGTTCTCTCCTGG - Intergenic
908805358 1:67924947-67924969 CAATCACTGGAGATTTCTCCCGG + Intergenic
909150481 1:71996677-71996699 GAAAGATTACAGATTTCCCCAGG - Intronic
911778709 1:101847423-101847445 TAATATCTACAGATTTCTCTGGG + Intronic
916655423 1:166871119-166871141 TAAAAACTACAGATATCCCCAGG - Intronic
917466153 1:175278156-175278178 AAACAACTACATTTTTCCCCCGG + Intergenic
919684000 1:200464700-200464722 AAATAGCTACAGATTTAGCCAGG + Intergenic
919778128 1:201207173-201207195 CTGTAACTACAGACTCCCCCCGG - Exonic
922426349 1:225499374-225499396 CAAGAACTGCAGATTTGGCCAGG + Intronic
923041985 1:230326087-230326109 CAATAATTACACATTTTCACGGG - Intronic
923597116 1:235369188-235369210 CAAGGACTACACATTTCACCTGG + Intronic
924673855 1:246155682-246155704 CAAGAACTACACATCTCGCCAGG + Intronic
1070049830 10:72877517-72877539 CAATAACTAAATATTTACTCTGG + Intronic
1070335349 10:75450102-75450124 TAATAACTACAAATTCTCCCTGG + Intronic
1073066874 10:100766229-100766251 CAAAATATACAGAGTTCCCCAGG - Intronic
1073780821 10:106836568-106836590 CCTTAACTGCAGATTTCTCCCGG - Intronic
1075297819 10:121293557-121293579 CAAAAGCCACAGATGTCCCCAGG + Intergenic
1076410136 10:130243323-130243345 CAATAACCACAGATATCTCAAGG + Intergenic
1086052833 11:82614212-82614234 GAGTGACCACAGATTTCCCCAGG + Intergenic
1086437571 11:86797472-86797494 CTTTAACTACAGATGTCCCACGG - Intronic
1087364792 11:97204518-97204540 CAAGAACTACAGATTTAAACAGG - Intergenic
1089407593 11:118211230-118211252 CAAAAACAAAAGAATTCCCCAGG - Intronic
1091562899 12:1628499-1628521 CAATAACTACAGATTTCCCCAGG - Intronic
1092322444 12:7491506-7491528 CAACAACTACAGTTTTCCCCTGG + Intronic
1107462905 13:40621174-40621196 CAAACACTACAGATTTTACCTGG - Intronic
1108900612 13:55402689-55402711 GAATAAATACAGATTTTCTCAGG - Intergenic
1110446837 13:75593634-75593656 CTAGAACTACAGAATTCCACAGG - Intronic
1112071495 13:95855969-95855991 CAATACCTTCAATTTTCCCCTGG + Intronic
1115192439 14:30760161-30760183 CAGTCACTACACATTTCCCACGG + Intergenic
1115694452 14:35881494-35881516 GAGTAACTACAGTTATCCCCAGG + Intronic
1118505512 14:66406862-66406884 CAATAGCTACAGCTTTTCTCTGG + Intergenic
1118535593 14:66760113-66760135 CATTTACTACCCATTTCCCCCGG + Intronic
1119622145 14:76139047-76139069 TAATAACTGCAAATTTTCCCTGG - Intergenic
1120404839 14:84081889-84081911 CAATCACCACTGATTCCCCCAGG - Intergenic
1128769577 15:70271825-70271847 CAATGACTACAGAGTTTCCTTGG - Intergenic
1129897508 15:79119353-79119375 CAATGACGACAGCTTTCCCTTGG + Intergenic
1131909470 15:97181318-97181340 CAATAGCTTCAGGTTTCTCCTGG - Intergenic
1135963855 16:27019918-27019940 CAATACATAAAGATTTCCCTCGG - Intergenic
1139005594 16:62567742-62567764 TAAAAATCACAGATTTCCCCAGG - Intergenic
1140974219 16:80043759-80043781 CATGAACAACAGATGTCCCCTGG - Intergenic
1149641694 17:58206856-58206878 GTATAATTAGAGATTTCCCCTGG - Intronic
1150892897 17:69174924-69174946 CAATAACTACACATTTCCATTGG - Intronic
1151527822 17:74682973-74682995 CAAAAACAACAGATGTCCCATGG + Intronic
1156364312 18:36411709-36411731 TAATAACTACAGCATTCTCCTGG - Intronic
1156963416 18:43060737-43060759 CAGTGACTACAGATTTTCTCTGG + Intronic
1158827619 18:61241329-61241351 CAGTAACTACTGACTTCCCTGGG + Intergenic
1159734046 18:72072099-72072121 CAATAACAAAACATATCCCCTGG + Intergenic
1167804021 19:51766707-51766729 AAAAAACTACAGAAGTCCCCGGG + Intronic
925043627 2:753418-753440 CAATGACATCAGATTACCCCTGG - Intergenic
926078640 2:9964807-9964829 CAGTAAATACAGATTTGCACAGG - Intronic
930519787 2:52449951-52449973 CAATAAGAAAAGATTTCCTCTGG + Intergenic
936663573 2:114569340-114569362 CACTCACTCCAGATTTCCCTCGG - Intronic
939105271 2:137941556-137941578 CAGTAGTTACAGATTTCCCAGGG + Intergenic
940725729 2:157333847-157333869 CAATGACTGAAGCTTTCCCCAGG - Intergenic
942363860 2:175200909-175200931 CAATAACTCCCAATTTCCCCTGG - Intergenic
942649239 2:178149497-178149519 CAATAAGGAGAGTTTTCCCCAGG - Intergenic
943294114 2:186115294-186115316 CCATACCCACAGAATTCCCCTGG - Intergenic
947642938 2:231717090-231717112 CAAAAACAATAGATGTCCCCTGG - Intergenic
1170391890 20:15884238-15884260 CCATAGCTTCTGATTTCCCCAGG - Intronic
1171053837 20:21886711-21886733 CAAGCACTAGAGATTGCCCCAGG - Intergenic
1171064987 20:22006747-22006769 CAACAACTATTTATTTCCCCTGG - Intergenic
1178842547 21:36149396-36149418 AAATAACTACAAATTTGCCAAGG + Intergenic
1182291363 22:29282477-29282499 GAGTAACTACAGTTATCCCCAGG + Exonic
955344655 3:58152253-58152275 CACTAACTTCAGATGTCCTCCGG + Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962651306 3:137495916-137495938 CAAAAACTACAGAGTACCCAGGG - Intergenic
962702383 3:138012122-138012144 CAGGATCAACAGATTTCCCCAGG - Intronic
963404677 3:144847290-144847312 CAATAACTACAGTTTTTCTCTGG - Intergenic
964897447 3:161614745-161614767 CAATAACTTCAAAATTCCTCAGG - Intergenic
965123431 3:164593791-164593813 TAATAACTCCAGTTTTCCCTTGG - Intergenic
966071828 3:175887343-175887365 CAATCACTGGAGATTTCTCCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968342183 3:197965534-197965556 CAATAACTACAGAATAGGCCAGG - Intronic
971678119 4:29661315-29661337 CAATAACCACATTTCTCCCCAGG + Intergenic
972205577 4:36768299-36768321 CCATAATTCCAGATTTCACCAGG + Intergenic
972552969 4:40150028-40150050 CAGTAACTACAGACTACCACAGG - Intronic
973051465 4:45603416-45603438 TAATAAGTACAGATTGTCCCAGG - Intergenic
977243850 4:94605882-94605904 CAATATCTACATATTACCACAGG - Intronic
978979668 4:114927982-114928004 CACTAAAAACACATTTCCCCCGG + Intronic
982271030 4:153588489-153588511 CAAGAACTACTGTTTTCCCTCGG + Intronic
982486108 4:155967918-155967940 CATTAGCTACAGATTTCTTCTGG - Intergenic
984150555 4:176124783-176124805 CAATAATTACAAATTTCACTGGG - Intronic
985481774 5:116598-116620 CTATCACTACAGTTTTACCCCGG - Intergenic
988545243 5:32150367-32150389 AAATAGCAACAGATTTTCCCTGG + Intronic
993099352 5:83518156-83518178 CAATAACTACAGGTTTCTTCAGG + Intronic
1000589581 5:163143033-163143055 CAATAAATACAGATTTTTCATGG + Intergenic
1004245307 6:13969563-13969585 CAATAACAACAGGTGTCCACTGG + Intronic
1004436558 6:15600763-15600785 CCATCACTACAGATTTATCCAGG - Intronic
1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG + Intergenic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1011918019 6:92534246-92534268 CAATGACTATAGACATCCCCAGG + Intergenic
1018576448 6:165264644-165264666 CAATAACTGCAGTGATCCCCTGG - Intergenic
1020339906 7:7099074-7099096 CAATATTTCTAGATTTCCCCAGG - Intergenic
1023653346 7:42393216-42393238 CAAAATCTACAGATTTCCAATGG + Intergenic
1023951022 7:44845596-44845618 CAACAACTACAAAATTCCCCAGG + Intronic
1026581547 7:71622764-71622786 CCATAAATACAGATTCTCCCAGG + Intronic
1027959487 7:84927055-84927077 CAAGAACTACAGTTTTCCACTGG - Intergenic
1034045936 7:147927730-147927752 AAATAACTACTGATATTCCCTGG + Intronic
1038728232 8:30101072-30101094 CATTAACTACAGATATTCTCGGG + Intronic
1039512678 8:38104563-38104585 CAATATCTACGTATTTCCCATGG + Intergenic
1042274597 8:66990806-66990828 CAAAAATTATAGATTTTCCCAGG - Intronic
1046556430 8:115779149-115779171 CAATTAGTACACATTTCCTCAGG + Intronic
1047190031 8:122669948-122669970 CACTAACAACAGAATACCCCTGG + Intergenic
1051837016 9:21350698-21350720 ACATGACTTCAGATTTCCCCAGG - Exonic
1051999975 9:23266554-23266576 CAAGAGCTCCAGATTTCCCCAGG + Intergenic
1052963578 9:34320710-34320732 AAATAGCTACAGATCTCCCTTGG + Intronic
1059919251 9:119139238-119139260 CAATAATTATAGGTCTCCCCAGG + Intergenic
1059946405 9:119412821-119412843 CAGTAAGTACAGAATTCACCGGG + Intergenic
1191645650 X:63478288-63478310 CAAAAACTACACTTTTCCCAAGG + Intergenic
1192817078 X:74605104-74605126 CAATACCTGCAGAGGTCCCCTGG + Intronic
1193552776 X:82918724-82918746 CAAATACTACAGATTTTCACTGG - Intergenic
1193861895 X:86678457-86678479 CAATTACTACAGTTTTCACTTGG + Intronic
1194213347 X:91096992-91097014 AAGTAATTACACATTTCCCCTGG - Intergenic
1195682505 X:107559439-107559461 CTACAACTACAGTTTTCCCTTGG - Intronic
1198307710 X:135399332-135399354 CCATAACTACAGCTTTCACTGGG - Intergenic
1198951273 X:142075254-142075276 CAATAACCAAAGCTATCCCCAGG + Intergenic
1200751554 Y:6949569-6949591 AAATGAATACAGATTTCCGCAGG + Intronic