ID: 1091563375

View in Genome Browser
Species Human (GRCh38)
Location 12:1630575-1630597
Sequence GCCCTCGAGGACCACGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091563363_1091563375 29 Left 1091563363 12:1630523-1630545 CCTGGCGTCGGCAGTGTCCCCGG 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG 0: 1
1: 0
2: 1
3: 8
4: 75
1091563367_1091563375 12 Left 1091563367 12:1630540-1630562 CCCCGGTGCAGCTGCTGGGCAAG 0: 1
1: 0
2: 0
3: 30
4: 229
Right 1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG 0: 1
1: 0
2: 1
3: 8
4: 75
1091563368_1091563375 11 Left 1091563368 12:1630541-1630563 CCCGGTGCAGCTGCTGGGCAAGG 0: 1
1: 0
2: 3
3: 54
4: 501
Right 1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG 0: 1
1: 0
2: 1
3: 8
4: 75
1091563370_1091563375 10 Left 1091563370 12:1630542-1630564 CCGGTGCAGCTGCTGGGCAAGGT 0: 1
1: 0
2: 1
3: 74
4: 474
Right 1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG 0: 1
1: 0
2: 1
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091563375 Original CRISPR GCCCTCGAGGACCACGGTGC CGG Intronic
900187573 1:1339552-1339574 GCCCTCGGGGCACACGGGGCGGG - Intronic
900409183 1:2505107-2505129 GCCCTCGTGGCCCACGGAGCAGG - Exonic
901143408 1:7050211-7050233 ACCATGGAGGACCAGGGTGCAGG - Intronic
903073191 1:20739008-20739030 GTCCTCAAAGACCACCGTGCAGG + Intergenic
903999210 1:27328948-27328970 GCCCTACAGGACCTGGGTGCTGG - Intronic
906196859 1:43934992-43935014 TCCCTCGATGACCACAGAGCCGG - Intronic
913317735 1:117566709-117566731 GACCTCCAGGACCTCGGGGCTGG + Intergenic
915236417 1:154486566-154486588 GCCCTCTCGGACCACAGTGAGGG - Exonic
919770277 1:201154157-201154179 CCCCTCGAGGACCCCTCTGCCGG - Exonic
920559680 1:206930342-206930364 GGCCTCGGCGGCCACGGTGCTGG + Exonic
920746671 1:208635579-208635601 GCCATCCAGGACCGAGGTGCTGG + Intergenic
921923137 1:220690447-220690469 GCCCTCGGGGCCCGCGGCGCAGG - Exonic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1063899757 10:10720142-10720164 GCCCTTGACTACCACTGTGCAGG + Intergenic
1067213550 10:44281704-44281726 GCCCCTGAGGACAAGGGTGCTGG + Intergenic
1075088795 10:119431319-119431341 GCCCTGGAGGAGCTCGGGGCAGG + Intronic
1075159606 10:120011699-120011721 GCCCTCGAGGAGCTCGGTGCTGG + Intergenic
1075334164 10:121597171-121597193 ACCCTCGCGGACCACGGACCTGG - Intronic
1076164747 10:128272722-128272744 GCCCTCAGGGACCACGCTGCAGG + Intergenic
1077167629 11:1150874-1150896 GCCCCCAAGGCCCACGGTTCTGG - Intergenic
1077280024 11:1739896-1739918 ACCATCCAGGAGCACGGTGCAGG + Intronic
1081983609 11:47285552-47285574 GCCCCCGAAGCCCTCGGTGCTGG - Exonic
1083470589 11:62881414-62881436 GCCTTCCAGGGCCACGGCGCGGG + Exonic
1084064262 11:66694272-66694294 GCCCAGGAGGACCAGGGTGCAGG - Exonic
1084849612 11:71928365-71928387 CTCCTCGAGGTCCACGGTCCCGG - Intronic
1089646884 11:119886347-119886369 CCCCTCCAGGCCCACGGTGGGGG + Intergenic
1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1097264918 12:57739021-57739043 GCCCTCGCAGACATCGGTGCTGG - Intronic
1104146672 12:126040657-126040679 GTCCTCTAGGACCACAGTGATGG - Intergenic
1104994976 12:132648689-132648711 GCCCGCGAGGTCCATGTTGCGGG - Intronic
1110630114 13:77697898-77697920 GCCCTCGGGGCCCACGATGATGG + Intronic
1113385363 13:109843132-109843154 TCCCTGGAGGATGACGGTGCTGG - Intergenic
1122930940 14:104932844-104932866 GCCCGCGGGGGCCACGGTGCAGG + Exonic
1124515931 15:30367493-30367515 GCCCACGATGATCATGGTGCTGG + Exonic
1124651417 15:31476965-31476987 GCACTGGAGGGCCACCGTGCTGG + Exonic
1124726989 15:32163238-32163260 GCCCACGATGATCATGGTGCTGG - Exonic
1128877602 15:71215062-71215084 GCCCCCGAGGACGACGGCGGCGG + Exonic
1141470589 16:84235811-84235833 GCCCTGGGGGAGCTCGGTGCTGG + Intronic
1141812208 16:86383182-86383204 GCCCTCGCGAGCCAGGGTGCTGG - Intergenic
1141904067 16:87011429-87011451 GCCCTCGGAGACGATGGTGCAGG + Intergenic
1146957188 17:36942602-36942624 GCCCTCGCGGGCCTGGGTGCAGG - Intronic
1147419551 17:40315581-40315603 GCCCTCCAAGACCATGGTGCGGG - Intronic
1148326377 17:46785675-46785697 GCCCGGGAGGACCATGGTTCTGG + Intronic
1148796517 17:50199784-50199806 GCCCTCGGGGACTTCGGCGCCGG + Exonic
1150690983 17:67366634-67366656 CCCCTCGAGGTCCCCGGCGCTGG + Intergenic
1152436346 17:80278594-80278616 GCCCTGGAGGCAGACGGTGCTGG + Intronic
1152664428 17:81559136-81559158 GCCCTGGAGGAACAAGGGGCTGG - Exonic
1153285650 18:3452163-3452185 GCCAGGGAGGACCACGGCGCTGG - Exonic
1158546762 18:58404060-58404082 GCCCTCCAGGCCCACAGTACTGG - Intergenic
1160081066 18:75727570-75727592 GCCCACGAGTGCCATGGTGCTGG + Intergenic
1161395268 19:4042174-4042196 GCCCTGAGGGTCCACGGTGCAGG + Intergenic
1164995770 19:32719877-32719899 GCCCTCGCGGACCCCGGGGTCGG - Intronic
1165797292 19:38526511-38526533 GCCCTCAAGGACCAAGGTGAGGG - Intronic
1166120447 19:40683213-40683235 TCTCGGGAGGACCACGGTGCCGG - Intronic
929824796 2:45301861-45301883 GCCCCCGAGGCCCAGGGTTCAGG + Intergenic
938647810 2:133349469-133349491 GCCGTCGAGGAAGACAGTGCTGG - Intronic
948052006 2:234985768-234985790 GAGCTCAAGGAGCACGGTGCAGG + Intronic
1169254339 20:4085675-4085697 GCCCTCGGAGAGCACGGGGCTGG - Intergenic
1173606759 20:44337171-44337193 GCCTGCCAGGCCCACGGTGCTGG - Exonic
1175899996 20:62356200-62356222 GCCCTCGAGGACAGCTGTCCAGG - Intronic
1178927950 21:36791712-36791734 GCCCTCGAGGGCCACGGAAGCGG + Intronic
1179474616 21:41635208-41635230 GCCCTAGAGGGGCACGGGGCTGG - Intergenic
1180090338 21:45531002-45531024 GCCCTGGGGGGCCACGGGGCAGG + Intronic
1181996442 22:26886580-26886602 GCCTTTGAGGGCCATGGTGCTGG - Intergenic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185268858 22:49919057-49919079 GGACTCCAGGACCACGGTGGAGG - Intronic
962258123 3:133886023-133886045 GCCCTGGAGGACCTCCCTGCAGG - Intronic
964457845 3:156887312-156887334 GCCCTTGAGGTGCACAGTGCAGG + Intronic
985145162 4:186889054-186889076 GGCCCCGGGGCCCACGGTGCTGG + Intergenic
1000196470 5:158963920-158963942 GCCCTCAAGGAGCTCGCTGCTGG + Intronic
1001932497 5:175683292-175683314 GACCGCAAGGACCACGGTGATGG - Exonic
1006029893 6:31170852-31170874 CCCCTCCAGGACCTCAGTGCAGG + Intronic
1014913892 6:127121257-127121279 CCCAGCGAGGACCACGGCGCAGG + Intronic
1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG + Intergenic
1019286588 7:226317-226339 GCCCTGGAGGGTCACAGTGCAGG + Intronic
1021716923 7:23469585-23469607 GCCCCCGAGGCCCAGCGTGCCGG + Intronic
1024043769 7:45574304-45574326 GCCGCCGAGGACCACGGTCGGGG + Intronic
1026986576 7:74558921-74558943 CCCCTCGATGATCACGGAGCCGG - Exonic
1029543417 7:101198051-101198073 GCCCACGTGGGCCTCGGTGCAGG + Intronic
1029701333 7:102248652-102248674 GCCCTCGGGGACCCCGGGCCCGG + Exonic
1036646253 8:10612706-10612728 GCCCTCGGGGAGGCCGGTGCTGG + Exonic
1044839776 8:96327783-96327805 GCTGTCCAGGACCACGGGGCTGG - Intronic
1203772988 EBV:58868-58890 GCCCCTCAGGACCACGGAGCTGG + Intergenic
1195212023 X:102659763-102659785 GCTCTGGAGGACCACTGGGCTGG - Intergenic