ID: 1091565335

View in Genome Browser
Species Human (GRCh38)
Location 12:1644018-1644040
Sequence ACGGATAAGCATCTCTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091565335_1091565338 -4 Left 1091565335 12:1644018-1644040 CCCTGCAAGAGATGCTTATCCGT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1091565338 12:1644037-1644059 CCGTGCTCCGAGTTGCTAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091565335 Original CRISPR ACGGATAAGCATCTCTTGCA GGG (reversed) Intronic
903285475 1:22274278-22274300 ATGGAAAAGCATCTCGTGCCAGG - Intergenic
909148100 1:71964186-71964208 ACGCAGAAGCATCTGTGGCATGG - Intronic
912333969 1:108845512-108845534 ATGGAAAAGCATCTCCTGGAAGG - Intronic
916386145 1:164272682-164272704 AGAGATAAGAATCTCTTTCAGGG + Intergenic
920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG + Intergenic
920202531 1:204268384-204268406 AGGGAGAAGCAGCTCTAGCAGGG - Intronic
921142165 1:212319356-212319378 AAATATCAGCATCTCTTGCAGGG + Intronic
1067156040 10:43782190-43782212 ACTGATAAGCACTTCCTGCATGG + Intergenic
1070259003 10:74835292-74835314 ATGGATGAACATCTCTTGGATGG - Intronic
1074048741 10:109863516-109863538 TCCTATAAGCATTTCTTGCAGGG - Intergenic
1074669876 10:115778144-115778166 ATAAATAAGCATCTCTTGAAAGG - Intronic
1074774531 10:116757312-116757334 AGGGAGAAGCAGCTCTCGCATGG + Intergenic
1076324651 10:129611755-129611777 AGGGAGAAGCATCTCATCCAAGG - Intronic
1078806235 11:14707952-14707974 ATGGAGAAGCATCCCTTGGAAGG + Intronic
1079022522 11:16921353-16921375 ACTTTTAAGCATCACTTGCATGG - Intronic
1091565335 12:1644018-1644040 ACGGATAAGCATCTCTTGCAGGG - Intronic
1096772694 12:53946110-53946132 AAGGATAAACATCTCTTCCAAGG + Exonic
1098202057 12:68066761-68066783 TCTGTTAAGCATCTCTTGTACGG + Intergenic
1113533411 13:111045687-111045709 CAGGATAAGCAAGTCTTGCATGG - Intergenic
1120031161 14:79642612-79642634 ACAGATAAGGAGATCTTGCAGGG - Intronic
1128716597 15:69913257-69913279 GCAGATAAGCAGCCCTTGCATGG - Intergenic
1143266533 17:5642202-5642224 ATGGAAAAGCTTCTCTTTCATGG - Intergenic
1146167767 17:30603499-30603521 AGGTATAAACATTTCTTGCATGG + Intergenic
1146220172 17:31011417-31011439 AGGTATAAACATTTCTTGCATGG + Intergenic
1154030833 18:10752773-10752795 CAGGATCAGCATCTTTTGCATGG - Exonic
931134334 2:59378971-59378993 CAGGTTAAGCATTTCTTGCAGGG - Intergenic
933193872 2:79367388-79367410 AGGGGAAAGCATCTCTGGCAGGG + Intronic
939040218 2:137179823-137179845 GAGGATAAGCATCTCAGGCAGGG - Intronic
944860604 2:203812360-203812382 AGGGATAAGCATCCCATGAAAGG + Intergenic
1172948695 20:38707990-38708012 ACACCTAAGGATCTCTTGCAGGG - Intergenic
1179279358 21:39921203-39921225 GGGGAAAAGCATCTCTTGGATGG - Intronic
1181854379 22:25771680-25771702 ATGGATCAGCCTTTCTTGCAAGG - Intronic
1182177211 22:28302958-28302980 ATGTATAAGCTTTTCTTGCAGGG - Intronic
951792903 3:26506074-26506096 ACTGATAATCATCTCTGTCAGGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
968148633 3:196320165-196320187 ATGGAGAAGCTTCTCTTGCTGGG - Intronic
969262863 4:6044548-6044570 ACAGATAAGCATATTTTGGATGG + Intronic
978602339 4:110441955-110441977 AAGAATAAGAATCTCCTGCATGG - Intronic
980220374 4:129905633-129905655 ATGGATAAGAATCACTTGGAAGG - Intergenic
980688685 4:136262717-136262739 TCCCTTAAGCATCTCTTGCATGG - Intergenic
982933232 4:161436089-161436111 AAGGATAAGTATCTTTTGCTTGG - Intronic
990118562 5:52420061-52420083 ACAGATAAGGAACTCTGGCATGG - Intergenic
990661192 5:58017194-58017216 ACGGATAAGCATATCTTGAGAGG - Intergenic
993622636 5:90186873-90186895 ACGGACAAGCAGCTCTGGGAAGG + Intergenic
995318381 5:110802576-110802598 TCGCATAAGAATCTCTTGTAAGG + Intergenic
999912685 5:156222036-156222058 ACGGTTAAGCTTATTTTGCATGG + Intronic
1006619920 6:35356593-35356615 CTGGATAATCATCTCTTGTATGG + Intronic
1008027608 6:46655885-46655907 AAGGAGAAGCAGCTCTTGCTCGG + Exonic
1008168870 6:48177203-48177225 AAGGATAATCATTTCTGGCAAGG - Intergenic
1011584624 6:88910963-88910985 TCCCATAAGCATCTCTTGTAAGG - Intronic
1012036426 6:94146951-94146973 TAGGATAAGCATCTTCTGCAAGG - Intergenic
1013687304 6:112600631-112600653 ACGGATCATCACCTCCTGCAAGG + Intergenic
1019568827 7:1698682-1698704 GCTGACAAGCTTCTCTTGCATGG - Intronic
1021321029 7:19211792-19211814 ACTGACAAGCCTCTGTTGCAGGG - Intergenic
1023092928 7:36633195-36633217 AAGGATGTGCATCTCTAGCAAGG - Intronic
1037022897 8:13995769-13995791 AAGGATAAGGATCTCTTGCCTGG - Intergenic
1046065109 8:109186979-109187001 ATGGATGGGTATCTCTTGCATGG + Intergenic
1050441940 9:5673294-5673316 AAAGATAAGCATCACTAGCAAGG + Intronic
1055233820 9:74094351-74094373 AAGGAAAGGCATGTCTTGCATGG - Intergenic
1060712657 9:125884782-125884804 AAGGATAAACATCTCTTACAAGG - Intronic
1195707747 X:107750333-107750355 ATGAATAAGCATCCCTGGCATGG + Intronic