ID: 1091565795

View in Genome Browser
Species Human (GRCh38)
Location 12:1647017-1647039
Sequence AGTATAACGTCCACGCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091565795_1091565798 -3 Left 1091565795 12:1647017-1647039 CCAGGCTGCGTGGACGTTATACT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1091565798 12:1647037-1647059 ACTGTCTTCCCCCACCCCCGGGG 0: 1
1: 0
2: 0
3: 26
4: 244
1091565795_1091565800 1 Left 1091565795 12:1647017-1647039 CCAGGCTGCGTGGACGTTATACT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1091565800 12:1647041-1647063 TCTTCCCCCACCCCCGGGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 313
1091565795_1091565797 -4 Left 1091565795 12:1647017-1647039 CCAGGCTGCGTGGACGTTATACT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1091565797 12:1647036-1647058 TACTGTCTTCCCCCACCCCCGGG 0: 1
1: 0
2: 3
3: 50
4: 446
1091565795_1091565796 -5 Left 1091565795 12:1647017-1647039 CCAGGCTGCGTGGACGTTATACT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1091565796 12:1647035-1647057 ATACTGTCTTCCCCCACCCCCGG 0: 1
1: 0
2: 1
3: 25
4: 228
1091565795_1091565801 2 Left 1091565795 12:1647017-1647039 CCAGGCTGCGTGGACGTTATACT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1091565801 12:1647042-1647064 CTTCCCCCACCCCCGGGGAGGGG 0: 1
1: 0
2: 4
3: 37
4: 387
1091565795_1091565799 0 Left 1091565795 12:1647017-1647039 CCAGGCTGCGTGGACGTTATACT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1091565799 12:1647040-1647062 GTCTTCCCCCACCCCCGGGGAGG 0: 1
1: 0
2: 0
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091565795 Original CRISPR AGTATAACGTCCACGCAGCC TGG (reversed) Exonic