ID: 1091566303

View in Genome Browser
Species Human (GRCh38)
Location 12:1651000-1651022
Sequence GCTTTCAGCAGAATATCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091566301_1091566303 -8 Left 1091566301 12:1650985-1651007 CCGGGTGGTGGGGAGGCTTTCAG 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1091566303 12:1651000-1651022 GCTTTCAGCAGAATATCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091566303 Original CRISPR GCTTTCAGCAGAATATCAGG AGG Intergenic
901537189 1:9890215-9890237 GTTTTCAGCTGAATTTCAAGAGG - Intronic
904976302 1:34459552-34459574 GCTGTCATCATAATATCTGGTGG + Intergenic
905488912 1:38328401-38328423 GCCTTTGGCAGAACATCAGGTGG - Intergenic
911321376 1:96417218-96417240 GCCTGCAGCAGAGTATCAGGAGG + Intergenic
911926492 1:103838663-103838685 ATTTTCAGCAAAATATCAGAAGG + Intergenic
916972083 1:170032313-170032335 ACTTTCAACAGATTATCAAGTGG + Intronic
917006526 1:170421573-170421595 ACTTTCAGGAGAATAGCATGAGG + Intergenic
918598752 1:186326487-186326509 GGTGTCAGCAAAATATCAAGTGG + Intronic
919572606 1:199267805-199267827 GCTTTGAGCAGTCTATCAGCTGG + Intergenic
920536549 1:206741048-206741070 GCTGTCAGCAGCAAATCTGGGGG + Intergenic
921677925 1:217997448-217997470 AGTGGCAGCAGAATATCAGGTGG + Intergenic
922194564 1:223348836-223348858 GCTTTCAGCAGAATCTCAGATGG - Intronic
922334833 1:224610388-224610410 ACTATCAGGAGAATAGCAGGGGG - Intronic
923412789 1:233726294-233726316 GCTTTCACCATATTAACAGGGGG + Intergenic
1062900247 10:1138462-1138484 GCTTTCAGCTGAAGATGAGAAGG + Intergenic
1071333133 10:84581071-84581093 GCTTTCTGGAAAATAGCAGGGGG + Intergenic
1072734663 10:97870921-97870943 GCTTTCAGCAGATTCTCAAAGGG + Exonic
1076962594 10:133777061-133777083 GCTTTCAGGAAAGCATCAGGGGG + Intergenic
1077886072 11:6389298-6389320 TTTTTCAGCAGAATTTCAGAGGG - Intergenic
1078149934 11:8749786-8749808 CCTTTCTGCTGAATGTCAGGTGG - Intronic
1078834106 11:15009748-15009770 GCTTTTATCAGAATGTCAGATGG + Intronic
1079624589 11:22600737-22600759 GCTTTCAGCAGATTTTCAAATGG - Intergenic
1081396978 11:42597852-42597874 GCTCTCTGCAGCATACCAGGTGG + Intergenic
1083109086 11:60387426-60387448 TCTTTCAGTCAAATATCAGGTGG + Intronic
1088810941 11:113391685-113391707 GGTTTCAGGGGAAAATCAGGAGG + Intronic
1091447371 12:551723-551745 GGTTTCAGGAGAGGATCAGGTGG + Intronic
1091566303 12:1651000-1651022 GCTTTCAGCAGAATATCAGGAGG + Intergenic
1092889373 12:12954472-12954494 GCTGTCAGCAGAACTGCAGGAGG + Intergenic
1094612893 12:32010642-32010664 GCTTACAGCAGAGGAGCAGGAGG + Intergenic
1094660140 12:32462071-32462093 GGTTTCTGCATAATATCAGGTGG + Intronic
1101572148 12:105963415-105963437 GCTATCTGCAGAATATAACGGGG + Intergenic
1103484403 12:121273376-121273398 GCTGGCAGCAGAATGGCAGGAGG + Intronic
1106277767 13:28230002-28230024 GCTCTCAGCAGATTAGGAGGAGG - Intronic
1107738255 13:43420670-43420692 GACTTAAGCAGAATTTCAGGTGG + Intronic
1107918491 13:45178134-45178156 TGTTTCATCAGAATCTCAGGAGG - Intronic
1108714039 13:53061312-53061334 GCTGTGAGCAGAATATCAATTGG + Intergenic
1110472804 13:75878948-75878970 GTTTTCAGAAAAATATCAGAGGG + Intronic
1114502742 14:23183210-23183232 CCTTTCAGCAGAATTCCAGCCGG - Exonic
1114603592 14:23976831-23976853 ACTTTCAGCAAAATATCACAAGG + Intronic
1114608602 14:24019605-24019627 ACTTTCAGCAAAATATCACAAGG + Intergenic
1115039382 14:28904242-28904264 TCTTTCAGCAGAATTTAATGTGG + Intergenic
1116051355 14:39807356-39807378 GCATGCATCAGAATACCAGGAGG + Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1120594153 14:86413571-86413593 GCTTACAGCAGGATGCCAGGAGG - Intergenic
1125389504 15:39176771-39176793 GCTTGCAGTAAAATATCAGATGG - Intergenic
1127632942 15:60843117-60843139 CCTTGCAGCAGAACAGCAGGGGG - Intronic
1131930064 15:97431960-97431982 GCTTTCAGCCAAGTGTCAGGTGG - Intergenic
1131972629 15:97907402-97907424 GCTATCAGTAGAATATCACAGGG - Intergenic
1133033654 16:3023189-3023211 GCCTTCTGCAGAATCACAGGCGG - Intronic
1134809264 16:17153408-17153430 GCTTAGAGCAGAATATTAAGGGG - Intronic
1140573518 16:76136742-76136764 GCTTACAGCAAATTAGCAGGTGG + Intergenic
1143172606 17:4938856-4938878 GCCTTCAGCAGAAAGCCAGGGGG + Exonic
1144402029 17:14914651-14914673 GCATTCAACAGAATATTAAGAGG + Intergenic
1149997021 17:61410906-61410928 ACTTTCAGCAGGACATTAGGAGG + Intergenic
1150362944 17:64553619-64553641 ACATTCAGCAGAATATTATGTGG - Intronic
1150663648 17:67109329-67109351 GCTTTCTCCTGCATATCAGGCGG - Exonic
1151882247 17:76902816-76902838 GCTTTCAGCAGGACAACTGGGGG + Intronic
1152083332 17:78202454-78202476 GCTGTCAGCACAAGCTCAGGTGG - Intronic
1152564551 17:81094373-81094395 GCTTTCAGCAGATTGGCAAGGGG - Intronic
1152951708 17:83238747-83238769 GCTTTCAGGAAAGCATCAGGGGG + Intergenic
1155435599 18:25809490-25809512 GTTTTCATCTCAATATCAGGAGG + Intergenic
1157223023 18:45840559-45840581 GCCTTCAGCAGAGTGCCAGGGGG - Intronic
1159446963 18:68552911-68552933 ACTTTCAGGAGAATATAAGGAGG + Intergenic
1168727742 19:58597785-58597807 GCTTTCAGGAAAGCATCAGGGGG + Intergenic
925813086 2:7720404-7720426 GCTGTCAGGAGAATAGCATGGGG + Intergenic
926058998 2:9793540-9793562 GCTATCAGGAGAACAGCAGGGGG - Intergenic
927527146 2:23755386-23755408 GGTTTCAGCAAAATGTGAGGAGG - Intronic
928886698 2:36157373-36157395 GCTATCATGAGAATATCAAGGGG + Intergenic
929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG + Intergenic
929974482 2:46618255-46618277 GTTTTCATCAGATTATCAGAGGG - Intronic
930026503 2:47032259-47032281 GCTTTCAGCAGATTCTCAAAGGG + Intronic
930661145 2:54054436-54054458 TCTGTCAGCAGAATATCACAAGG - Intronic
931106193 2:59059036-59059058 GTTTTCAGCAGAATATTAGTTGG - Intergenic
933002328 2:76941059-76941081 TCTTTCAACAGAATATGAGAAGG + Intronic
934895960 2:98120185-98120207 CCTTTCACCAGAACAACAGGTGG + Intronic
936570818 2:113613407-113613429 GCTTTCAGGAAAGCATCAGGGGG - Intergenic
939149553 2:138456633-138456655 GCTTTCAAGAGAACATCAGCTGG - Intergenic
939608029 2:144275804-144275826 GTTTTTATCAGAATCTCAGGTGG - Intronic
940928513 2:159396455-159396477 GCTTTAAATAGAGTATCAGGTGG - Intronic
942453704 2:176123605-176123627 GGTTTCAGCAATAAATCAGGGGG - Intronic
942792368 2:179775053-179775075 CTTTGCAGCAGAAGATCAGGAGG - Intronic
942983648 2:182112713-182112735 GTTTTCAGCAGAATCTCAGTGGG - Intronic
945335577 2:208588841-208588863 GCTGTGTGCAGAATATCAGGTGG + Intronic
947113498 2:226744867-226744889 GCATTGAGGAGAATATCAGGGGG + Intronic
948113873 2:235479424-235479446 GCTTTCAGCAGTGTTTCAAGTGG - Intergenic
948717053 2:239871858-239871880 GCTTTCAGCAGAGAACCATGGGG + Intergenic
1169593126 20:7166673-7166695 GTTTTCAACAGAAAAGCAGGTGG - Intergenic
1170175952 20:13470180-13470202 GCTTGTATCAGAATGTCAGGAGG - Intronic
1170965768 20:21069713-21069735 GCTATCACGAGAATAGCAGGGGG + Intergenic
1173118125 20:40265476-40265498 GCTTTCAACAGACTATCAAATGG + Intergenic
1174217010 20:48923408-48923430 GCTTTCATCAGATTTTCAGAGGG + Intronic
1174640700 20:52041458-52041480 GCTTTCATCAGATTCTCAGTAGG + Intergenic
1177017047 21:15804309-15804331 GATTTCAGAGGAATATTAGGAGG + Intronic
1179410931 21:41162671-41162693 GCTTTCAGGAGCATATCAGTTGG - Intergenic
1180263178 21:46689579-46689601 GCTTTCAGGAAAGCATCAGGGGG + Intergenic
1182450882 22:30420262-30420284 GCTTTCATCAGATTCTCAAGGGG + Intronic
1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG + Intergenic
1185267183 22:49910467-49910489 GCGTGCAGTAGAACATCAGGTGG + Exonic
1185429383 22:50797473-50797495 GCTTTCAGGAAAGTATCAGGGGG + Intergenic
951867862 3:27327460-27327482 GCTGACAGCAGAATGGCAGGTGG - Intronic
952943127 3:38458292-38458314 GCTTTCATCAGATTCTCAGAGGG - Intronic
952948657 3:38499320-38499342 GCAACCAGCAGAATAACAGGAGG + Intronic
953494129 3:43372003-43372025 GCTTGCAGCAGCCTGTCAGGCGG + Intronic
954461233 3:50628138-50628160 GCTTTCAGAAGAATGACAGCTGG - Intronic
955494377 3:59516339-59516361 GCTATCACCAGAATATTGGGGGG - Intergenic
955515290 3:59720446-59720468 TCTTGCAACAGAATAACAGGAGG + Intergenic
957079712 3:75626313-75626335 GCTTTCAGGAAAGCATCAGGGGG - Intergenic
965135477 3:164761139-164761161 CTTTTCTTCAGAATATCAGGAGG + Intergenic
968231059 3:197004832-197004854 GCTTTCATCAGATCTTCAGGAGG - Intronic
968373213 4:14238-14260 GCTTTCAGGAAAGCATCAGGGGG - Intergenic
972356841 4:38287286-38287308 GCATTCAGCGGCATCTCAGGAGG + Intergenic
974419345 4:61652180-61652202 AACTTCATCAGAATATCAGGAGG + Intronic
976701655 4:87975829-87975851 GCATTCAGCTGAATTTCATGGGG + Intronic
977606268 4:98988086-98988108 GCTTTCAGAAGATCATAAGGTGG + Intergenic
978580198 4:110224235-110224257 TCTTTTAGCAGAGTATCAGAGGG - Intergenic
978646950 4:110945548-110945570 GCTTTCACCAGATTCACAGGAGG - Intergenic
982365740 4:154576278-154576300 ACTTGAAGCAGAATATCTGGAGG + Intergenic
985462181 4:190118330-190118352 GCTTTCAGGAAAGCATCAGGGGG + Intergenic
985465825 4:190194541-190194563 GCTTTCAGGAAAGCATCAGGGGG + Intergenic
985953611 5:3243198-3243220 GTTTTCAGTTGTATATCAGGTGG - Intergenic
987425175 5:17764990-17765012 GATTTTAGCAGAACATTAGGAGG - Intergenic
987434136 5:17872934-17872956 GTTTTCAGCTGAAGTTCAGGAGG - Intergenic
988293992 5:29330832-29330854 GTGTTGAGCAGAATGTCAGGAGG - Intergenic
988696309 5:33625983-33626005 GCCTTCAGCAGAATCAGAGGTGG + Intronic
991228113 5:64296575-64296597 GCTTTCAGAAGAATCTCAGTAGG + Intronic
993832317 5:92775559-92775581 GCTTCCAGCAAAACATCAGTGGG + Intergenic
996235672 5:121126895-121126917 GCTATCATGAGAATATCAAGGGG - Intergenic
1001460728 5:171911271-171911293 GCTAGCATCAGAATAACAGGAGG + Intronic
1001644332 5:173269098-173269120 GGTGTCAGCAGAACAGCAGGTGG - Intergenic
1002354945 5:178619654-178619676 GCTTTCAGCAGATTTTCAAAGGG - Intronic
1009612453 6:65963828-65963850 GTTTTCCCCAGGATATCAGGAGG - Intergenic
1010021537 6:71165307-71165329 GCTTTCACCAGATTCACAGGAGG + Intergenic
1011227615 6:85125215-85125237 GATTTCATCAGAATGACAGGAGG - Intergenic
1012176304 6:96089657-96089679 GCTTTCAGCATATTGACAGGAGG + Intronic
1012858739 6:104533638-104533660 GCTTTCTGTAGAACACCAGGAGG - Intergenic
1013854854 6:114560219-114560241 GCTTTCAGCAGGAAATCAATGGG + Intergenic
1013854989 6:114561530-114561552 GCTTTCAACAGAATTGAAGGAGG + Intergenic
1013985855 6:116192794-116192816 GGTTTCAGCTTAATACCAGGAGG - Intronic
1014969805 6:127800693-127800715 GAGTGCAGCAGAATATAAGGAGG + Intronic
1015038658 6:128689628-128689650 GATTTCAGGAGAAAATCAGAGGG + Intergenic
1018047947 6:159981131-159981153 GCTTCCAGCAGAAGAGCAGCAGG - Intronic
1018738269 6:166706502-166706524 GCTTCCAGAAGAATTGCAGGAGG - Intronic
1019234782 6:170601768-170601790 GCTTTCAGGAAAGTATCAGGGGG + Intergenic
1029016395 7:97319199-97319221 GCTTTCTGTAGAATATCAAATGG - Intergenic
1029219702 7:98978554-98978576 GCTGTCTGCTGAATAGCAGGTGG + Intronic
1031560306 7:123230507-123230529 GCTTTCACCAGATTCCCAGGAGG - Intergenic
1031695829 7:124852094-124852116 GCTTTCATCAGATTTTCCGGGGG + Intronic
1034684739 7:152960003-152960025 GCTTTCAACAGAAAATTATGAGG + Intergenic
1040548530 8:48420751-48420773 GCTGTCAGCAGCATCCCAGGAGG + Intergenic
1041063892 8:54062287-54062309 GCTTTCACCAGATTCACAGGAGG - Exonic
1041759247 8:61346222-61346244 GATTACATCAGAATTTCAGGGGG + Intronic
1044239429 8:89871115-89871137 GCTTTCAGCAGAACTGGAGGAGG + Intergenic
1044413580 8:91911247-91911269 TCATTCAGCAAAATATCAGTCGG - Intergenic
1045792760 8:106004347-106004369 GCTATCAGAAGAAGATGAGGGGG + Intergenic
1047141646 8:122147421-122147443 TTTTTAAGCAGAATATCATGTGG + Intergenic
1047188784 8:122659367-122659389 CCCCTCAGCAAAATATCAGGTGG + Intergenic
1047713530 8:127575065-127575087 GCTTTCTGCAGAATGGCTGGGGG - Intergenic
1050996546 9:12226991-12227013 TATTTCTGCAGAAAATCAGGGGG + Intergenic
1055746594 9:79453585-79453607 GCTTTCAACAAAATATCACAAGG - Intergenic
1055758104 9:79576451-79576473 TCTTTCAGAAGAATAACAAGAGG - Intronic
1056263274 9:84870760-84870782 GCTTACAGCATAATATCACATGG + Intronic
1056628577 9:88274293-88274315 GCTTTCATCAGAATCTCAAAAGG + Intergenic
1057969759 9:99543194-99543216 GCTTTCAGGGAAATATCAGGAGG - Intergenic
1192438704 X:71158940-71158962 GCTTTCATCAGAATCTCAAAAGG - Intronic
1195881657 X:109599198-109599220 GCATTCAGTAGAAATTCAGGGGG - Intergenic
1196522813 X:116694229-116694251 GCTCTCAGCAGTATATAAAGCGG - Intergenic