ID: 1091566304

View in Genome Browser
Species Human (GRCh38)
Location 12:1651001-1651023
Sequence CTTTCAGCAGAATATCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091566301_1091566304 -7 Left 1091566301 12:1650985-1651007 CCGGGTGGTGGGGAGGCTTTCAG 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1091566304 12:1651001-1651023 CTTTCAGCAGAATATCAGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091566304 Original CRISPR CTTTCAGCAGAATATCAGGA GGG Intergenic
901764190 1:11489534-11489556 CTCTCTGCAGAATAACTGGAGGG - Intronic
902803107 1:18843180-18843202 CATTCTGCAGAATATCACGCTGG + Intronic
902989599 1:20177319-20177341 CTTACAGCAGAAGAGGAGGAGGG + Intronic
907697900 1:56752524-56752546 CTGTCAGAAGAATAAGAGGAGGG + Intronic
907793921 1:57695511-57695533 GTTTCAGCAAAATATAAGGAAGG + Intronic
908079991 1:60566629-60566651 ATTTCAGCTGATTTTCAGGAGGG - Intergenic
909095078 1:71276308-71276330 CTTTCAGAAGAACAGCAGCATGG - Intergenic
911864183 1:102995012-102995034 CTATCAGGAGAACATCATGAGGG + Intronic
912135674 1:106657570-106657592 CTATCAGGAGAACAGCAGGAGGG - Intergenic
912659491 1:111515502-111515524 CTTTCAGCAGATGACAAGGAAGG + Intronic
913396919 1:118381684-118381706 CTTTCAGAGGAATTTAAGGATGG - Intergenic
913987413 1:143577525-143577547 CTCTCAGCAAAATATCACAAGGG - Intergenic
916736490 1:167611949-167611971 CTTACTGCATCATATCAGGATGG + Intergenic
916972084 1:170032314-170032336 CTTTCAACAGATTATCAAGTGGG + Intronic
917006527 1:170421574-170421596 CTTTCAGGAGAATAGCATGAGGG + Intergenic
917545572 1:175963418-175963440 CTTTCTGCAGTATAGCAGAAAGG + Intronic
917728754 1:177853544-177853566 CTTTAAGCGGAATAGTAGGAAGG - Intergenic
919825136 1:201498280-201498302 CTTTCAACAGAAGTTCATGAGGG + Intronic
921490267 1:215767169-215767191 ATTTCATCACAATATAAGGAAGG - Intronic
921617717 1:217290840-217290862 CTTTCAGGAGAATAGCATGGAGG - Intergenic
922194563 1:223348835-223348857 CTTTCAGCAGAATCTCAGATGGG - Intronic
1063748128 10:8910236-8910258 TTTGCTGCAGAATATCAAGATGG + Intergenic
1063907328 10:10794748-10794770 ATTTCAGCAGAAGAGTAGGATGG - Intergenic
1065299945 10:24312156-24312178 CTTTCAGCACAAGGGCAGGACGG + Intronic
1066253358 10:33655229-33655251 CTTTCAGCAGAAAATTAGCCCGG + Intergenic
1066493469 10:35917773-35917795 ATTTATCCAGAATATCAGGAGGG - Intergenic
1070210625 10:74316462-74316484 CTATCAGGAGAATAGCATGAAGG - Intronic
1070347067 10:75554937-75554959 ATTTAAGCAGAATATCAGCCAGG + Intronic
1071759477 10:88583960-88583982 CTTCCAGTACAATGTCAGGAGGG - Intronic
1071825830 10:89324791-89324813 TTTTCAGCAAAATATCACAAAGG - Intronic
1075553201 10:123409331-123409353 CATCCAGCTGAAAATCAGGAAGG - Intergenic
1075833293 10:125429308-125429330 CTTTCAGAAGAATACCTGGAAGG - Intergenic
1080352838 11:31405020-31405042 CTTTCAGGAGAGTAGAAGGAGGG + Intronic
1081392420 11:42544446-42544468 CTTTCTGCATAATATCACTAAGG + Intergenic
1082305888 11:50574377-50574399 GTTTCAGTAGAATATGAGAAGGG - Intergenic
1083109087 11:60387427-60387449 CTTTCAGTCAAATATCAGGTGGG + Intronic
1086903517 11:92393762-92393784 CATTAAGCAGAATAGCATGAAGG + Intronic
1087256905 11:95966197-95966219 CTTCCACCAGAAGATCAGGTAGG + Intergenic
1087926892 11:103929253-103929275 CTTTAAGCAGAATAGAGGGATGG + Intronic
1088079472 11:105893573-105893595 CTTTCAGCATAAGAACAGGATGG + Intronic
1088830776 11:113534898-113534920 CTTTAAGTATAATGTCAGGAAGG + Intergenic
1091566304 12:1651001-1651023 CTTTCAGCAGAATATCAGGAGGG + Intergenic
1092838198 12:12511946-12511968 GTTTGTGCACAATATCAGGATGG + Intronic
1093052694 12:14521044-14521066 CTTGCAGCAGAGCCTCAGGATGG - Intronic
1095665786 12:44796249-44796271 ATATCAGCAAAATTTCAGGATGG + Intronic
1102027578 12:109722317-109722339 CTTTCAGCAGAGTAACAGTGAGG + Intronic
1102621315 12:114197020-114197042 CTATCAGGAGAATAGCAAGAGGG - Intergenic
1103484404 12:121273377-121273399 CTGGCAGCAGAATGGCAGGAGGG + Intronic
1104010260 12:124925276-124925298 CTGGCAGCAGAAGAGCAGGATGG + Intergenic
1106057242 13:26250035-26250057 CTTTCAGAAGGTTATAAGGAGGG - Intergenic
1106083866 13:26523129-26523151 AATGCAGCAGAATATCAGGCTGG + Intergenic
1106794684 13:33192483-33192505 CTTTAAGCAGAATATTTGAATGG - Intronic
1107203628 13:37753878-37753900 CTTTCAGCTGACTATGAGTAAGG + Intronic
1108980523 13:56507171-56507193 CTATCAGGAGAACATCATGAGGG + Intergenic
1109161932 13:58986102-58986124 ATGTCAACAGATTATCAGGATGG + Intergenic
1109802161 13:67394898-67394920 GTTTAAGCAAAATATCAGGAAGG - Intergenic
1109917320 13:69007376-69007398 CTATCAGGAGAACAGCAGGAGGG + Intergenic
1111657453 13:91171612-91171634 CTATCACGAGAATAGCAGGAGGG + Intergenic
1112925300 13:104666842-104666864 CTTTCAGGTGAAAATCAGTATGG + Intergenic
1115146557 14:30233447-30233469 CTTTCAGCTGCCTATCATGAAGG - Intergenic
1115375404 14:32670188-32670210 CTATCACAAGAATAGCAGGAGGG + Intronic
1115785149 14:36817306-36817328 CTTTCTGCAGAAGTTCAGCAAGG + Intronic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118608319 14:67519525-67519547 CTTACACCAGAGTATCCGGATGG - Intronic
1119569323 14:75656209-75656231 CTTTCAGAAGAGTACCATGAAGG + Intronic
1120316378 14:82898712-82898734 CTTCCAGAAGAATATCAGGAAGG + Intergenic
1121787639 14:96674376-96674398 CTTTCAGCAGGGTCTCTGGAGGG - Intergenic
1122338827 14:101011600-101011622 CATTAAGCAGAATATTAGGGTGG - Intergenic
1124997477 15:34737629-34737651 CTGTCAGCAGAGTGTCAGGCTGG - Intergenic
1125993573 15:44134284-44134306 CTTACAAAAGAATATCTGGAAGG + Intronic
1129371260 15:75097069-75097091 CTTTCACCATATTCTCAGGATGG + Intronic
1129506251 15:76083911-76083933 CTTTGAGCAGAGTATTAGGATGG + Intronic
1130965356 15:88693586-88693608 CTTACTGCAGTATATCAGGCCGG - Intergenic
1133368914 16:5233250-5233272 ATTTCAGCAGAACAAGAGGAGGG + Intergenic
1135012805 16:18897864-18897886 CTCTCAGGAGAAAATCAGTAGGG - Intronic
1135319724 16:21485448-21485470 CTCTCAGGAGAAAATCAGTAGGG - Intergenic
1135372560 16:21916936-21916958 CTCTCAGGAGAAAATCAGTAGGG - Intergenic
1135439225 16:22453767-22453789 CTCTCAGGAGAAAATCAGTAGGG + Intergenic
1135830855 16:25771561-25771583 CTTTCCACAGAAGATAAGGAAGG - Intronic
1136329952 16:29567161-29567183 CTCTCAGGAGAAAATCAGTAGGG - Intergenic
1136444581 16:30306865-30306887 CTCTCAGGAGAAAATCAGTAGGG - Intergenic
1140154758 16:72412460-72412482 CTTTCAGTAGAATTTGAGGGTGG - Intergenic
1140344243 16:74196598-74196620 CTTTCAGAAGAAGATCAGGCTGG - Intergenic
1141345333 16:83239786-83239808 CTTACAGCAGAAGAGCAGGCAGG + Intronic
1146753104 17:35400133-35400155 CTCCCAGCAGAATATGAGGCAGG + Intergenic
1149743193 17:59068214-59068236 CTTTCAGCAGCTCATCAGGCAGG - Intronic
1149997022 17:61410907-61410929 CTTTCAGCAGGACATTAGGAGGG + Intergenic
1150226285 17:63526267-63526289 GTTTCAGGACAATTTCAGGAAGG - Intronic
1151123130 17:71815151-71815173 CTTTCTGGAGAATAACAGCAAGG - Intergenic
1151645604 17:75429095-75429117 CTCTGCACAGAATATCAGGAAGG - Intergenic
1152839619 17:82558667-82558689 CTTTCTGCAGAAGTTCAGGGTGG + Intronic
1156224316 18:35088270-35088292 CTTTCATCTGAATGTCAAGAAGG + Intronic
1156526989 18:37777090-37777112 CCTTCAGCAGGCTATCTGGAAGG - Intergenic
1157172145 18:45417570-45417592 CTATCAGGAGAATAGCAGCATGG + Intronic
1157580782 18:48773001-48773023 CTCTCAGCTGAATTTCAGTAAGG - Intronic
1159688489 18:71455566-71455588 ATTTCACCAGAATATAAGTATGG - Intergenic
1159760367 18:72418703-72418725 CTTTCAGGAGAACAGCATGAGGG - Intergenic
1160352032 18:78191302-78191324 ATTTCTGAAGAATATCAGCAAGG - Intergenic
1161171108 19:2812924-2812946 CTTTCATCAGAATCTCAGAGCGG - Intronic
1164535519 19:29084048-29084070 CTTGCAGCAGAATCAGAGGAAGG + Intergenic
1167676126 19:50887220-50887242 CTTTCCGCAGAGGCTCAGGATGG + Intergenic
927125814 2:20012050-20012072 CTAACAGCAGAGTCTCAGGAAGG + Intronic
927133700 2:20081364-20081386 TTTTCAGCAGAATCTCTGGCAGG - Intergenic
927457722 2:23271567-23271589 CTCAGAGCAGAATATCAGAAAGG - Intergenic
927606777 2:24492242-24492264 CTTTCGGCTGAATCCCAGGAAGG - Intronic
930048359 2:47193666-47193688 CTTTCATCAGATTCTCAGAAAGG + Intergenic
930578866 2:53185458-53185480 CTTTCAAATGAATATCAGGATGG - Intergenic
931033125 2:58206801-58206823 CTTTCAGATTAATATCAGCATGG + Intronic
931622641 2:64226692-64226714 CTATCAGGAGAATAGCACGAAGG - Intergenic
933129138 2:78651280-78651302 GTTTCAGTGGAGTATCAGGAAGG - Intergenic
933355529 2:81205739-81205761 CTTGCATCAGAATCACAGGAGGG + Intergenic
933853023 2:86385954-86385976 CTTGAAGCAGAACATCAGGATGG + Intergenic
934962322 2:98687552-98687574 TTTGCAGAAGAATATTAGGAGGG - Intronic
937686385 2:124702620-124702642 AGTTCAGCAGAATTTCAGAAGGG + Intronic
939849721 2:147290184-147290206 CTTTCAGTTGCATATCAGGGAGG + Intergenic
939849724 2:147290210-147290232 CTTTCAGTTGCATATCAGGGAGG + Intergenic
942983647 2:182112712-182112734 TTTTCAGCAGAATCTCAGTGGGG - Intronic
943328812 2:186534387-186534409 CTTTCATAAAAATATGAGGAAGG - Intergenic
943799179 2:192036303-192036325 CTTCCAGCAGAATATCCAGTTGG - Intronic
943862467 2:192885866-192885888 CTTTCAGCTGGAGATCAGAAAGG - Intergenic
944458312 2:199918058-199918080 CTGTCACCAGAACAGCAGGAGGG + Intronic
944905815 2:204260938-204260960 CTTTCAGCAGAAGATCACTCTGG + Intergenic
945335578 2:208588842-208588864 CTGTGTGCAGAATATCAGGTGGG + Intronic
945771587 2:214049755-214049777 CTGTGAGCAGTATCTCAGGATGG + Intronic
946016625 2:216609149-216609171 TTTCCAGAAGCATATCAGGAAGG - Intergenic
947296066 2:228631956-228631978 TTTTCATTAGAAAATCAGGAAGG + Intergenic
1169269370 20:4187481-4187503 CTTTCTACAGAGGATCAGGAAGG - Exonic
1170096933 20:12656363-12656385 ATCTCATCAGAATATCATGAAGG + Intergenic
1171059409 20:21941816-21941838 CTTTTTGCATAAAATCAGGATGG + Intergenic
1172607287 20:36222523-36222545 CTTTGAGCAGCAAATCAGGAAGG - Intronic
1177017048 21:15804310-15804332 ATTTCAGAGGAATATTAGGAGGG + Intronic
1177087453 21:16724569-16724591 CTTTCAGAAAAAAATCAGTAAGG - Intergenic
1177498262 21:21917159-21917181 CTTTGAGCAAAACAACAGGAAGG + Intergenic
1177734991 21:25077976-25077998 CTTGCAGCAGAGCATCATGAAGG + Intergenic
1184200437 22:42964962-42964984 CTTTCAGCAGCATATGAGGAAGG - Intronic
1185147625 22:49147846-49147868 CTTTAAGCAGAAAACCAGGGCGG - Intergenic
949112006 3:272421-272443 CTTTCAGAAATATTTCAGGAAGG + Intronic
949215307 3:1560318-1560340 CTATCAGAAGAATACCAGCACGG - Intergenic
952506891 3:34015560-34015582 CTGTCAGCAGAACATGTGGATGG - Intergenic
953182972 3:40613684-40613706 CTTCCAGGAGAGTATCTGGAAGG - Intergenic
955299948 3:57768690-57768712 CTTTCACAGGAATATCAGGTTGG - Intronic
955862255 3:63344125-63344147 CTTTTATCAAAATGTCAGGAGGG - Intronic
961107826 3:124257332-124257354 CATTCATCAGAATATCTGGAAGG + Intronic
961119202 3:124359094-124359116 TTTTCATCAGACTATCATGAAGG + Intronic
962918193 3:139927594-139927616 CTTTCAAGAAAATATCAGCAAGG + Intergenic
963347790 3:144116482-144116504 TTTTCAGCTGAAAATCAGGCAGG - Intergenic
964319809 3:155483036-155483058 CCTTCAGCAGAAGATAAAGATGG - Exonic
964579559 3:158217847-158217869 CTTTGAGCAGAATATAATGGTGG + Intronic
964638826 3:158886446-158886468 ATTTCAACAGAAAATCTGGAGGG - Intergenic
966304891 3:178520566-178520588 CTCTCAGCAGAATATGTAGAGGG + Intronic
966860401 3:184228548-184228570 CTCTCTGCAGAATCTCAGTATGG + Intronic
969528163 4:7714692-7714714 CTTTCAGCAGAGTCCCTGGATGG - Intronic
970106060 4:12585823-12585845 CTTTCAACAGACTTTCATGAAGG + Intergenic
971131148 4:23812371-23812393 CTTTGAGCGGAAAATGAGGAGGG - Intronic
971149383 4:24014969-24014991 CTCTCGACAGAATATCACGATGG - Intergenic
972071701 4:35027892-35027914 GTTTCAGCTGAATATCAGAAAGG + Intergenic
972356842 4:38287287-38287309 CATTCAGCGGCATCTCAGGAGGG + Intergenic
976279075 4:83308776-83308798 ATTTCAGCAGAATAGAAGGATGG + Intronic
980762734 4:137256934-137256956 CTATAATCAGTATATCAGGAAGG + Intergenic
981301109 4:143186050-143186072 CTTGCTGCAGAACATCTGGAAGG + Exonic
984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG + Intergenic
984649681 4:182257093-182257115 CTTGCAGCAGAATCACTGGAAGG + Intronic
987434135 5:17872933-17872955 TTTTCAGCTGAAGTTCAGGAGGG - Intergenic
989289474 5:39746765-39746787 GTATCATGAGAATATCAGGACGG - Intergenic
994294565 5:98075510-98075532 TTTGCAGCAGAATACCAGAAAGG - Intergenic
994694937 5:103062436-103062458 GTTTTAGCAGAAGATCAGGCAGG - Intergenic
996820772 5:127624570-127624592 CTCTCAGCAGGATATCTGGAAGG + Intergenic
998783512 5:145684332-145684354 CTTTTAGCAGGATTTCATGAAGG - Intronic
1001232577 5:170001434-170001456 ATTTCAGCAGAAGAGCAGGGTGG + Intronic
1001460729 5:171911272-171911294 CTAGCATCAGAATAACAGGAGGG + Intronic
1002837548 6:877841-877863 CCTTCAGGAAAATGTCAGGAAGG - Intergenic
1004136951 6:12976655-12976677 ATTTCATCACAATATCAGAACGG - Intronic
1004935319 6:20501579-20501601 CATTAAGCAGAAAATCAGCAAGG + Intergenic
1005318431 6:24627507-24627529 CTTTCAGAAGAAAACAAGGAAGG - Intronic
1005704560 6:28438693-28438715 CTGTCACCAGAATAGCATGAAGG + Intronic
1008962007 6:57275640-57275662 CTTTAAACAGAATTTCTGGAAGG + Intergenic
1009375670 6:62965475-62965497 CTCTCAGTAGATTATCAGGGTGG - Intergenic
1009604465 6:65849066-65849088 ATTTCAGCATGATATCTGGAGGG + Intergenic
1010483036 6:76377801-76377823 CTCTCAGCAGAAACTCAGAAGGG - Intergenic
1013580478 6:111529387-111529409 CTTTGAGTAGAGAATCAGGAAGG - Intergenic
1013848605 6:114485771-114485793 GTTCCAGAAGAATATTAGGAGGG + Intergenic
1014399570 6:120971035-120971057 CTTGCATGAGAATTTCAGGAAGG + Intergenic
1014577221 6:123088690-123088712 TTTTCAGCAGATTAACAGAATGG - Intergenic
1014707321 6:124763502-124763524 CTATCAGGAGAATAGCACGAAGG + Intronic
1015904380 6:138102056-138102078 CATTCTGCAGAAGTTCAGGAAGG + Intronic
1016377510 6:143438263-143438285 ATTTCATCAGAATGTCAGCATGG - Intronic
1018047946 6:159981130-159981152 CTTCCAGCAGAAGAGCAGCAGGG - Intronic
1019294013 7:264489-264511 TTTCCAGCAGAATAAAAGGAAGG + Intergenic
1020505575 7:8983076-8983098 CTAGCAGCACAATAGCAGGATGG + Intergenic
1020610667 7:10393205-10393227 CTTTCAGCAGTTTATATGGAGGG - Intergenic
1021003682 7:15366432-15366454 CTTTAAGCAAAATATCATTATGG - Intronic
1021142612 7:17046015-17046037 CTTAAAGCAGAATATCAAGAAGG - Intergenic
1021944012 7:25707682-25707704 CTTAAAGGAGAATATCAGGGAGG - Intergenic
1023542129 7:41276829-41276851 CTTTAAGCAGAATGAAAGGAAGG - Intergenic
1025190076 7:56889588-56889610 CTCTCAGGAGAGTATGAGGAGGG - Intergenic
1025681864 7:63687333-63687355 CTCTCAGGAGAGTATGAGGAGGG + Intergenic
1030766730 7:113419561-113419583 AATCCAGCAGAAAATCAGGAAGG + Intergenic
1030945356 7:115712385-115712407 CTTCAATCAGAATATCAAGAAGG - Intergenic
1030992426 7:116316425-116316447 CTTTTAGGACAATATCAGAACGG + Intronic
1031200852 7:118683377-118683399 CTATCAGGAGAATAGCAGCATGG + Intergenic
1034895255 7:154872316-154872338 CTAGCAGCAGAATTTCAGGCAGG - Intronic
1035122234 7:156578523-156578545 CTGTCAGGTGAATATCAGGCTGG - Intergenic
1040995846 8:53401258-53401280 CTTTCAGCAGGATGACAGGAAGG - Intergenic
1041555363 8:59148589-59148611 CTTTCAGCATTGTATCAGTATGG + Intergenic
1043326587 8:79059883-79059905 CTTTAAGCACAATATAAGCATGG - Intergenic
1044051151 8:87506384-87506406 ATTTCAGCATACTATCAGGTAGG + Intronic
1045198205 8:99951554-99951576 CTTTTAGCAAGATATCATGAAGG - Intergenic
1045784174 8:105901957-105901979 CTATCACCAGAATAGCAAGAAGG + Intergenic
1047574092 8:126133965-126133987 CTACCAGCAGAGTATCAGTAAGG - Intergenic
1048316142 8:133363831-133363853 TTTTCAGCAGAATCACTGGAGGG + Intergenic
1048903284 8:139060861-139060883 CTTTCAGGAGAATAGAAGGGAGG - Intergenic
1049142999 8:140974719-140974741 CTTTCATCACATTATCAGAAAGG - Intronic
1050231950 9:3535849-3535871 CTCTGAGCAGAACATTAGGAAGG + Intergenic
1052363137 9:27581468-27581490 CTTGCAAGAGAATATCAGGCCGG + Intergenic
1053319319 9:37080953-37080975 CTTTCAAGAGAATCTGAGGATGG + Intergenic
1053323632 9:37121593-37121615 CTTTCAGGAGAATCTGAGCATGG + Intronic
1054263306 9:62893072-62893094 ATTTCAGTAGAAAATCATGAGGG - Intergenic
1056628578 9:88274294-88274316 CTTTCATCAGAATCTCAAAAGGG + Intergenic
1057902700 9:98961870-98961892 CTTGCAGTAAAATGTCAGGAAGG + Intronic
1059072689 9:111155358-111155380 CTTTCAGGTGAATTTCAGAATGG - Intergenic
1061490966 9:130944270-130944292 TTTTCAGCAGAACATCCTGATGG + Intergenic
1185934886 X:4245268-4245290 CATTCAGAAGAATGTCAGGATGG + Intergenic
1186598850 X:11014463-11014485 CTTTCGGCACAATATGTGGATGG - Intergenic
1190393542 X:49956536-49956558 GTTTCAGCTGAATATAAGGAAGG - Intronic
1192438703 X:71158939-71158961 CTTTCATCAGAATCTCAAAAGGG - Intronic
1192545459 X:72009144-72009166 TTTTCCCCAGTATATCAGGAAGG + Intergenic
1194442735 X:93953160-93953182 AGTTCAGCAGAACATCAAGAAGG - Intergenic
1195998579 X:110757099-110757121 TTTTAGGGAGAATATCAGGAGGG + Intronic
1196493506 X:116295952-116295974 CATTTAGCAGATTTTCAGGAAGG - Intergenic
1201716416 Y:17048910-17048932 CATTCAGAAGAATGCCAGGATGG + Intergenic