ID: 1091570510

View in Genome Browser
Species Human (GRCh38)
Location 12:1681369-1681391
Sequence AGTCTGACTCAACCACTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091570503_1091570510 23 Left 1091570503 12:1681323-1681345 CCCTTCCTGTTCTAGTTTATGGC No data
Right 1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG No data
1091570509_1091570510 -3 Left 1091570509 12:1681349-1681371 CCAGGCTCTGAAGGTTCGACAGT No data
Right 1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG No data
1091570508_1091570510 1 Left 1091570508 12:1681345-1681367 CCAGCCAGGCTCTGAAGGTTCGA No data
Right 1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG No data
1091570501_1091570510 27 Left 1091570501 12:1681319-1681341 CCTTCCCTTCCTGTTCTAGTTTA No data
Right 1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG No data
1091570505_1091570510 18 Left 1091570505 12:1681328-1681350 CCTGTTCTAGTTTATGGCCAGCC No data
Right 1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG No data
1091570504_1091570510 22 Left 1091570504 12:1681324-1681346 CCTTCCTGTTCTAGTTTATGGCC No data
Right 1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG No data
1091570500_1091570510 28 Left 1091570500 12:1681318-1681340 CCCTTCCCTTCCTGTTCTAGTTT No data
Right 1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091570510 Original CRISPR AGTCTGACTCAACCACTGAG AGG Intergenic