ID: 1091573681

View in Genome Browser
Species Human (GRCh38)
Location 12:1713266-1713288
Sequence GTATAGGGCTTGGGTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 80, 2: 61, 3: 54, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091573674_1091573681 0 Left 1091573674 12:1713243-1713265 CCTTTGGTATTTGAGAGAACAGG 0: 1
1: 4
2: 81
3: 81
4: 257
Right 1091573681 12:1713266-1713288 GTATAGGGCTTGGGTACAACTGG 0: 1
1: 80
2: 61
3: 54
4: 163
1091573672_1091573681 24 Left 1091573672 12:1713219-1713241 CCAGAACTGTGAACGATTCTGCT 0: 1
1: 17
2: 74
3: 77
4: 165
Right 1091573681 12:1713266-1713288 GTATAGGGCTTGGGTACAACTGG 0: 1
1: 80
2: 61
3: 54
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091573681 Original CRISPR GTATAGGGCTTGGGTACAAC TGG Intronic
901411973 1:9090573-9090595 TTATAGGGGTTGGGGACAACAGG - Intergenic
901946736 1:12710414-12710436 GTGTAAGGATTGGGGACAACAGG + Intergenic
904571429 1:31468960-31468982 GTATAAGGATTGGGAACAATAGG + Intergenic
905950543 1:41946967-41946989 GTATAAGGGTTAGGTACAGCTGG - Intronic
906583584 1:46956330-46956352 GTATAAGGGTTAGGTACAGCTGG - Intergenic
906701193 1:47859374-47859396 GTACAGGGCTGGGGTCCAACTGG - Intronic
907144831 1:52222461-52222483 GTGTAAGGATTGGGAACAACAGG + Intronic
907602383 1:55784310-55784332 GTATAAGGGTTAGGTACAGCTGG + Intergenic
907842560 1:58171497-58171519 GTATAGGGGTTGAGTACAACTGG - Intronic
908300623 1:62758126-62758148 GTATAGGGGTTGAGTACAACTGG - Intergenic
908659570 1:66422298-66422320 GTATAGGGGTTGGGTACAGCTGG + Intergenic
910591197 1:88929323-88929345 GTATAAGGGTTAGGTACAGCTGG - Intergenic
912021506 1:105112886-105112908 GTATAGGGGTTATGTACAACTGG - Intergenic
913382820 1:118229403-118229425 GTATAGGGGTTGGGTACAACTGG - Intergenic
913468863 1:119170859-119170881 GTATAAGGGTTAGGTACAGCTGG + Intergenic
913469736 1:119176166-119176188 GTATAGGGGTTGGGTACAACTGG - Intergenic
915260781 1:154675356-154675378 GTATAGGGGTTGGGTACAACTGG - Intergenic
915401304 1:155623930-155623952 GTATAAGGATTAGGTACAACTGG + Intergenic
915774388 1:158466819-158466841 GTAGAGAGCTTGGATACATCAGG + Intergenic
915955395 1:160216494-160216516 GTGTAGGGGTTGGGAAAAACAGG - Exonic
916083877 1:161254239-161254261 GTATAGGGGTTGGGTACAACTGG - Intergenic
916114650 1:161476432-161476454 GTATAGGGGTTAGGTACAACAGG - Intergenic
916939739 1:169665876-169665898 GTATAGGGGTTGGGTACAACTGG - Intronic
918074522 1:181160215-181160237 GTAAAGGGGTTGGGAGCAACAGG + Intergenic
919558913 1:199094391-199094413 GTATAGGGGTTGGGTACAACTGG - Intergenic
920908161 1:210190450-210190472 GTATATGGGTTGGGCACCACAGG - Intergenic
921019907 1:211226054-211226076 GTATAGGGGTTGGGTACAACTGG - Intergenic
1063321493 10:5056372-5056394 GTATAGGGATTGGGTACAACTGG + Intronic
1064603347 10:17014981-17015003 GTACAGGGGTTCAGTACAACTGG + Intronic
1065082634 10:22142658-22142680 GTATAGGGGTTGGGTACAGCTGG - Intergenic
1066483823 10:35824550-35824572 ATCTAGGGCCTGGGAACAACAGG - Intergenic
1066614367 10:37280785-37280807 GTATAGGGGTTGGGTACAACTGG + Intronic
1067134114 10:43593256-43593278 GTATACAGGTTGGGTACCACTGG + Intergenic
1067974397 10:51007699-51007721 GTTTAGGGCATGCTTACAACAGG - Intronic
1068142587 10:53026449-53026471 GTATAAGGGTTGGGTACAGCAGG + Intergenic
1068500526 10:57836541-57836563 GTATAGGGTTTGGATACAACTGG - Intergenic
1071200817 10:83219565-83219587 GTATATGGATTGGGAACTACTGG + Intergenic
1072371448 10:94769512-94769534 GTTTAGGGGTTGGGTACAACTGG + Intronic
1072377938 10:94837113-94837135 GTATAAGGGCTGGGTACAGCTGG + Intronic
1072471764 10:95719965-95719987 GTATAAGGGTTAGGTACAGCTGG + Intronic
1073970967 10:109045130-109045152 GTATAGGGGTTGGGTACAACTGG - Intergenic
1075008788 10:118850761-118850783 GTGTAAGGCTGGGGTAGAACCGG + Intergenic
1077572970 11:3355160-3355182 GTATAGGGGTTAGGGACTACAGG + Intronic
1079522622 11:21346412-21346434 TTATATGGCTTGGGTACAGTTGG - Intronic
1079657081 11:22997593-22997615 GTATAAGGATTGGGAACAACAGG + Intergenic
1079731001 11:23937722-23937744 GTATAGGGGTTGGGTACAACTGG + Intergenic
1080425128 11:32147897-32147919 TTATAAGGATTGGGTACAACTGG - Intergenic
1080726284 11:34902067-34902089 GTATAGGGATTAGGTACCACTGG - Intronic
1081421647 11:42878826-42878848 GTATAGGGGTTGGATACAACTGG - Intergenic
1083375668 11:62218315-62218337 GTGTATGGGTTGGGGACAACAGG - Intergenic
1084211231 11:67623876-67623898 GTATAGGGTTTGGGTACAACTGG - Intergenic
1085220962 11:74873361-74873383 GTATAGGGATTAGGGACCACTGG - Intronic
1086317609 11:85610350-85610372 GTATAGGGGTTGGGTACAACTGG - Intronic
1086443344 11:86849728-86849750 ATATAGGGGTTAGGTACAGCAGG - Intronic
1087075202 11:94122038-94122060 GTATAGGGGTTGGGTACAACTGG - Intergenic
1087683123 11:101236810-101236832 GTATAGGGGTTGGGTACAACTGG + Intergenic
1087966765 11:104424260-104424282 GTATAAGGCTTGTATACAATAGG - Intergenic
1088107775 11:106225346-106225368 GTGTAAGGGTTGGGGACAACAGG - Intergenic
1088492758 11:110403240-110403262 GTATAGGGGTTGGGTACAACTGG - Intergenic
1088930667 11:114348071-114348093 GTCTAAGGATTAGGTACAACTGG + Intergenic
1090178066 11:124669428-124669450 ATATGGGGCTTCGGTACACCTGG - Exonic
1091190219 11:133687424-133687446 CTATAGGGCTTGCTTACAAAAGG + Intergenic
1091573681 12:1713266-1713288 GTATAGGGCTTGGGTACAACTGG + Intronic
1092294223 12:7185372-7185394 GTATAAGGGTTAGGTACAGCTGG - Intergenic
1092472534 12:8792126-8792148 GTATAGGGGTTGGGTACAACTGG - Intergenic
1093022998 12:14220217-14220239 GTATAAGGATTAGGTACAACTGG - Intergenic
1093345464 12:18035136-18035158 TTATAGGGGTTGGGTACAACTGG - Intergenic
1094806618 12:34100402-34100424 GTATAAGGTTTAGGTACAGCTGG - Intergenic
1095125462 12:38471868-38471890 GTATAAGGGTTAGGTACAGCTGG - Intergenic
1095162728 12:38936225-38936247 GTATAAGGATTGGGAACAACAGG + Intergenic
1096351919 12:50907780-50907802 GTATAAGGGTTAGGTACAGCTGG + Intergenic
1098956375 12:76693805-76693827 GTATAGGGGTTGGGTACAGCAGG + Intergenic
1099104275 12:78480271-78480293 GTGTAGGGGTTGGGGACAATGGG - Intergenic
1099376471 12:81900287-81900309 ATATAGAGGTTGGGTACAGCTGG - Intergenic
1100092359 12:90986461-90986483 GTATAGGGGTTGGATACAATTGG - Intronic
1100210017 12:92390455-92390477 ATATAGGGGTTGGGTACAACTGG - Intergenic
1100530000 12:95454154-95454176 GTGTAAGGGTTGGGTACAACTGG + Intergenic
1104306392 12:127614092-127614114 GTGTAAGGGTTGGGTACAACTGG - Intergenic
1104767324 12:131338699-131338721 GTATAGGGGTTAGGTACAACTGG - Intergenic
1104851386 12:131876499-131876521 GTATAAGGGTTAGGTACAGCTGG + Intergenic
1105762708 13:23528693-23528715 GTATAGGGGTTGGGTACAACTGG - Intergenic
1106162925 13:27216571-27216593 GTATAGGGGTTGGGTACAACTGG - Intergenic
1108281897 13:48869664-48869686 GTATATGGCTTTGGCACCACAGG + Intergenic
1108848824 13:54704096-54704118 GTATAGGGGTTGGGTAAAACTGG - Intergenic
1109424669 13:62154111-62154133 GTATAGGGGTTGGGTACAGCTGG - Intergenic
1111372743 13:87337345-87337367 GTATAGGGGTTGGGTACAACTGG - Intergenic
1111755565 13:92390880-92390902 ATTTAGGGCTTTGGTTCAACTGG + Intronic
1112367016 13:98763960-98763982 GTATATGGGTTGGGTACCACTGG - Intergenic
1112519351 13:100082128-100082150 GTATAGGGGTTGGGTACAACTGG - Intergenic
1112538603 13:100284647-100284669 GTATAGGGGTTGGGTACAACTGG - Intronic
1113551277 13:111194929-111194951 GTATAGGGGTTGGGTACAACTGG + Intronic
1115285238 14:31708087-31708109 ATATAGGGGTTGGGTACAACTGG + Intronic
1121320438 14:92988668-92988690 GGACAGGGCTTGGGAACCACTGG + Intronic
1124795299 15:32772374-32772396 TTATATGGCATGGGTAAAACTGG + Exonic
1126071870 15:44872564-44872586 GTATAGGAGTTGGCTACAACTGG + Intergenic
1126086391 15:45014422-45014444 GTATAGGAGTTGCGTACAACTGG - Intergenic
1126523040 15:49618844-49618866 GTAGAAGGGTTGGGTACTACAGG + Intronic
1127074137 15:55309716-55309738 GTATAAGGGTTAGGTACAGCTGG + Intronic
1128362463 15:66972063-66972085 GTATAAGGGTTAGGTACAACTGG + Intergenic
1129653554 15:77508020-77508042 GCGTAGGGCTTGGGTGCAGCGGG - Intergenic
1135339449 16:21633622-21633644 GTATAGGGGTTGGGTACAACTGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136415332 16:30099637-30099659 GTGTAAGGGTTGGGAACAACAGG - Intergenic
1138494442 16:57399073-57399095 GTGTAGGGGTTGGGTACAGCTGG + Intergenic
1140119084 16:72067855-72067877 GTGTAAGGGTTGGGGACAACAGG - Intronic
1140512992 16:75521566-75521588 GTAGAGGGCGTGGGGAGAACTGG + Intergenic
1145804319 17:27715638-27715660 ATATAGGGGTTTGGTACAACTGG - Intergenic
1146310727 17:31766325-31766347 GTACAGGGGTTGGGTATAACTGG - Intergenic
1149074113 17:52577036-52577058 GTATAGGGGTTGGATACAGCTGG - Intergenic
1149213462 17:54329005-54329027 TTATAGGTATTGGGTACAACTGG - Intergenic
1149273930 17:55013965-55013987 GTATAAGGGTTAGGTACAGCTGG + Intronic
1151297594 17:73196830-73196852 GTAAAGAGCTTTGGTACATCAGG - Intronic
1151568241 17:74912209-74912231 GTATAGGGGTTGGGTACAACTGG - Intergenic
1155475902 18:26235796-26235818 GTATAGGGGTTGGGTACAACTGG + Intronic
1157349529 18:46872227-46872249 GTGTAAGGGTTGGGAACAACAGG - Intronic
1157857348 18:51115007-51115029 GTATAGGGGTTTGGTACAACTGG + Intergenic
1159164632 18:64684803-64684825 GTGTAGGGGTTGGGCACCACAGG - Intergenic
1160834555 19:1118504-1118526 GCAAAGGGCTTGGGCACCACAGG + Intronic
1161598005 19:5162081-5162103 GTATAGGGGTTGGGTACAACTGG + Intronic
1162108123 19:8383315-8383337 GTATAGGGGTTGGATACAACTGG - Intronic
1162237221 19:9318858-9318880 GTAAATGGGTTGGGTACAGCTGG + Intergenic
1162268202 19:9593550-9593572 GTGTAAGGATTGGGGACAACGGG + Intergenic
1162272741 19:9629703-9629725 GTATAAGGGTTGGGGACCACAGG - Intronic
1163661610 19:18581292-18581314 CTATAAGGGTTGGGTACAGCTGG - Intronic
1164070372 19:21762768-21762790 GAATAGGGCCTGGGTAAAACAGG + Intronic
1165847302 19:38826564-38826586 GTATAGGTGTTGGTTACAGCTGG - Intronic
1167904911 19:52651163-52651185 GTATATGGATTGGGAACAACAGG - Intronic
1168000203 19:53439636-53439658 GTATACGGGTTGGGTACCACTGG + Intronic
1168004684 19:53477134-53477156 GTGTACGGGTTGGGTACCACTGG + Intronic
1168227827 19:55009335-55009357 GTGTAGGGGTTGGGCACCACAGG + Intergenic
925433700 2:3818440-3818462 GTATATGGCTTTGGCACCACGGG + Intronic
925949682 2:8898858-8898880 TTATAGGGGTTGGGTACAACTGG + Intronic
926344983 2:11936769-11936791 GCATTGGGCTTGGGGTCAACGGG - Intergenic
926864624 2:17343687-17343709 GTATAAGGGTTAGGTACAGCTGG - Intergenic
928348001 2:30518664-30518686 GTATAAGGGTTAGGTACAGCTGG - Intronic
928617404 2:33054137-33054159 GTATAGGGGTTGGGTACAACTGG + Intronic
928677201 2:33661588-33661610 GTATAAGGGTTTGGTACAGCTGG - Intergenic
928980395 2:37130531-37130553 ATATAGGGGTTTGGGACAACAGG - Intronic
930038746 2:47104440-47104462 ATATAGGGGTTGGGTACAACTGG - Intronic
933175100 2:79165713-79165735 GTATAAGGGTTAGGTACAGCTGG + Intergenic
933920702 2:87042092-87042114 GTATAGGGATTGGGAACCACTGG - Intergenic
933930923 2:87151694-87151716 GTATAGGGATTGGGAACCACTGG + Intergenic
934002296 2:87727806-87727828 GTATAGGGATTGGGAACCACTGG + Intergenic
934867342 2:97824948-97824970 GTATAGGGGTTGGGTACAACTGG - Intronic
935748844 2:106212778-106212800 GTATAAGGGTTAGGTACAGCTGG - Intergenic
936362200 2:111813749-111813771 GTATAGGGATTGGGAACCACTGG - Intronic
936507214 2:113117219-113117241 GTATAGGGCATGGGGGTAACTGG + Intronic
938995922 2:136677500-136677522 CTCTAGGGATTGGGTACAGCGGG + Intergenic
939852069 2:147315224-147315246 GTATAGGGGTTGCGTACAACTGG - Intergenic
942494195 2:176521837-176521859 GTATAGGGCTGAGATAAAACAGG - Intergenic
943133965 2:183889287-183889309 GTATAGGGGTTGGGTACAACTGG - Intergenic
943441245 2:187931218-187931240 GCATAGGGATTGGGAACCACTGG + Intergenic
944729216 2:202500759-202500781 GTATAGGGGTTGGGTACAACTGG - Intronic
946207156 2:218118090-218118112 GTATAGGGGTTGGGTATAACTGG + Intergenic
947268200 2:228305373-228305395 GTATAGGGATTATGTACCACTGG + Intergenic
947370507 2:229440703-229440725 CTTTAGGGCTTGGGTACAGCAGG - Intronic
948069544 2:235109193-235109215 GTCTAGGGCAAGGGTACAAAAGG - Intergenic
948474787 2:238210356-238210378 GTGTAGGGGTTTGGGACAACGGG + Intergenic
1169169169 20:3450311-3450333 ATATATGGTTTGGGGACAACAGG + Intergenic
1174259605 20:49284315-49284337 GTAAAAGGATTGGGGACAACAGG + Intergenic
1174977268 20:55349646-55349668 GTATAAGGGTTAGGTACAGCTGG - Intergenic
1175801052 20:61801155-61801177 GTTGAGGGCTTGGGGACAAAAGG + Intronic
1176946719 21:14990948-14990970 GTAGAGCCCTTAGGTACAACTGG - Intronic
1177135276 21:17300620-17300642 GTATAGGGGTTGGCTACAGGTGG - Intergenic
1177896412 21:26859504-26859526 GTATAAGGGTTAGGTACAGCTGG - Intergenic
1179359526 21:40692938-40692960 GTATAGGGCTCCCGTAAAACTGG + Exonic
1179387721 21:40958124-40958146 GTATATGGGTTGGGCACCACAGG - Intergenic
1184064744 22:42111777-42111799 GTGTATGGGTTGGGGACAACAGG + Intergenic
949190231 3:1242343-1242365 GTGTAGGGGTTGGGCACCACAGG + Intronic
949555150 3:5146284-5146306 GTGTAGGGGTTGGGCACCACAGG + Intronic
949610266 3:5697042-5697064 GTATAAGGATTGGGAACAACAGG + Intergenic
950846491 3:16020838-16020860 GTGTAAGGATTGGGGACAACGGG + Intergenic
951020696 3:17778290-17778312 GTATAGGGGTTGGGTACAACTGG - Intronic
951838076 3:27004015-27004037 GTATAAGGGTTAGGTACAGCTGG - Intergenic
952940747 3:38442590-38442612 ATATAGGGGTTGGGTACAACTGG + Intergenic
953622725 3:44547075-44547097 GTATAGGGGTTGCATACAACTGG + Intergenic
954587192 3:51746175-51746197 GTATAGGGATTGGGTACAACCGG - Intergenic
955120008 3:56048762-56048784 CTGTAGAGCTTGTGTACAACGGG + Intronic
957000126 3:74875386-74875408 GTATAAGGGTTAGGTACAGCTGG + Intergenic
957915266 3:86680834-86680856 GTAGAGGTCTTAGGTAAAACTGG + Intergenic
957916349 3:86692815-86692837 ATATAGAGGTTGGGTACAGCAGG + Intergenic
958549026 3:95591636-95591658 GTATAGGGGTTGGGTACAACTGG + Intergenic
962491789 3:135901662-135901684 GTATTTGGCTAGGGTACTACGGG + Intergenic
963188113 3:142440712-142440734 GTATAAGGGTTAGGTACAGCTGG - Intronic
963696954 3:148574679-148574701 GTATAGGGGTTGGGTACAATTGG - Intergenic
963915925 3:150858772-150858794 GTATAAGGGTTAGGTACAGCTGG - Intergenic
963992088 3:151667090-151667112 GTATAAGGGTTGGGTACAACTGG + Intergenic
964064709 3:152563675-152563697 GTATAGGGGTTGGGTACAACTGG - Intergenic
964916765 3:161849833-161849855 GTATAGGGGTTGGGTACAGCAGG + Intergenic
965054641 3:163697476-163697498 GTATAAGGGTTAGGTACAGCTGG + Intergenic
965062942 3:163805420-163805442 ATATAGGGGTTGGGTATAACTGG - Intergenic
965080068 3:164022962-164022984 GTATAGGGGTTAGGGACCACAGG + Intergenic
965139400 3:164815336-164815358 GTATAGGGGTTGGGTACAACTGG - Intergenic
965335255 3:167425767-167425789 GTATACGGGTTGGGCACTACAGG - Intergenic
966353664 3:179057268-179057290 GTATAAGGGTTAGGTACAGCTGG - Intronic
967583866 3:191189612-191189634 GTATAGGGGTGGGTTACAACTGG - Intergenic
968729930 4:2264866-2264888 CTGCAGGGCTTGGGTCCAACTGG - Intergenic
971280997 4:25242530-25242552 GTATTGGGGTTGGGTACCACTGG + Intronic
971578666 4:28306871-28306893 GTATAGGGGTTGGGTATAACTGG - Intergenic
972133094 4:35861314-35861336 GTATAGGAGTCGGGTACAATGGG + Intergenic
973046053 4:45535286-45535308 GTATAGGAGTTGGGTACAACTGG - Intergenic
974174704 4:58308206-58308228 GTATAGGGGTTGGGTACAACTGG - Intergenic
974187522 4:58461942-58461964 GTATAGGGTTTGGGTACAACTGG - Intergenic
974526754 4:63056700-63056722 GTATAGGTGTTGGGTACAACTGG - Intergenic
974537326 4:63188487-63188509 ATATAGGGGTTGGGTACAACTGG - Intergenic
974838654 4:67278450-67278472 GTATAGGGGTTGGGTACAACTGG + Intergenic
975313652 4:72929096-72929118 GTATAAGGGTTAGGTACAGCTGG + Intergenic
975595625 4:76046331-76046353 GTATAGGGGTTGGGTACAACTGG + Intronic
977834732 4:101634429-101634451 GTATAGGGGTTGGATACAACTGG + Intronic
977884281 4:102239154-102239176 GTATAGGGGTTGGGTACAACTGG - Intergenic
978491572 4:109316330-109316352 GTATAGGGATTGGGAAACACTGG - Intergenic
978586636 4:110281756-110281778 GTATAAGGGTTAGGTACAGCTGG + Intergenic
979362000 4:119775750-119775772 GAATAGGGGCTGGGTAAAACAGG - Intergenic
980290705 4:130845376-130845398 GTATAGGGGTTGGGTGCAACTGG + Intergenic
980444372 4:132886564-132886586 GTATAAGGGTTAGGTACAGCTGG - Intergenic
982701323 4:158661836-158661858 GTATAGGGGTTGGGTACAACTGG - Intergenic
983834744 4:172373336-172373358 GAATAGGGGTTGGGTACAACTGG + Intronic
984554876 4:181201751-181201773 GTGGAGGGCTTGGCTTCAACTGG - Intergenic
984917648 4:184738292-184738314 GTATAGGGGTTGGGTACAACTGG - Intergenic
985078850 4:186244649-186244671 GTATATGGCTTTGGTACCATGGG + Intronic
987545049 5:19303490-19303512 GTATAGGGGTTGGGTACAACTGG + Intergenic
987818065 5:22929968-22929990 GTATAGGGGTTGGGTACAACTGG - Intergenic
987930083 5:24391012-24391034 GTAGAGGGGTTGGGTACAACTGG - Intergenic
988591813 5:32556006-32556028 GTATAGGGGTTGGGTACAACTGG + Intronic
989496369 5:42114715-42114737 GTATAGGGGTTGGGTACAACTGG - Intergenic
989613886 5:43320485-43320507 GTATAAGGACTGGGGACAACAGG + Intergenic
989957535 5:50374191-50374213 GTATAAGGGTTGGGTACAACTGG - Intergenic
990892445 5:60663451-60663473 GTATAAGGGTTAGGTACAGCTGG - Intronic
991215855 5:64156814-64156836 GTATATGGATTGGGGACAATAGG - Intergenic
991931515 5:71757415-71757437 ACATAGGGAATGGGTACAACAGG + Intergenic
992049564 5:72930165-72930187 GTATAGGAGTTGGGTACAACTGG - Intergenic
992455392 5:76911354-76911376 CTATAGGGGTTGGGTACAACTGG - Intronic
994231539 5:97314419-97314441 GTATAGGGATTGGGTACAATTGG + Intergenic
994454218 5:99984480-99984502 GTATAGGGGTTGGGTACAACTGG - Intergenic
994600170 5:101892873-101892895 GTCTAGGGCTTGGGGAGAAGAGG - Intergenic
995583224 5:113621950-113621972 GTATAGGGGTTGGGTATAACTGG + Intergenic
995706622 5:114994240-114994262 GTATAGGGGTTGGATATGACTGG - Intergenic
996680409 5:126224025-126224047 GTATAGGGATTGAGTACAACTGG - Intergenic
997689502 5:135816383-135816405 ATATAGTGCTTTTGTACAACTGG + Intergenic
998111650 5:139507179-139507201 GTATAGGGGTTGGGTACAACTGG - Intergenic
999732399 5:154484346-154484368 GTCTAGGGATTGGCTACAAGTGG - Intergenic
1000085419 5:157883876-157883898 GTATAAGGGTTGGGTACAACTGG - Intergenic
1000833987 5:166133502-166133524 GTATAAGGATTGGGAACTACTGG + Intergenic
1002057644 5:176607841-176607863 GTTTTGTGCTTGGGCACAACTGG - Intronic
1004531562 6:16459536-16459558 GTATAGGGGTTGGGTACAACCGG - Intronic
1004620078 6:17324223-17324245 GTATAGGGGTTAGGGACCACAGG + Intergenic
1004812433 6:19275076-19275098 GTATAGGGGTTGGGTACAACTGG - Intergenic
1005574903 6:27181639-27181661 GTGTAAGGATTGGGAACAACAGG - Intergenic
1006049895 6:31334084-31334106 GTATAAGGATTAGGAACAACAGG + Intronic
1007523559 6:42471010-42471032 GTATAGAGGCTGGGTAAAACAGG + Intergenic
1008582212 6:52917546-52917568 GTATAAGGGTTAGGTACAGCTGG + Intergenic
1009385758 6:63082944-63082966 GTATAGGGGTTAGGTATAACTGG + Intergenic
1009407523 6:63329378-63329400 GTATAGGGGTTGGGTACAACTGG + Intergenic
1009470994 6:64028482-64028504 ATATAGGGGTTGGGTACAACTGG - Intronic
1009872965 6:69471983-69472005 TTATAGGGGTTTGGTACAACTGG - Intergenic
1011076941 6:83447825-83447847 GTATAAGGGTTAGGTACAGCTGG - Intergenic
1011539695 6:88416721-88416743 GTATAAGGGTTAGGTACAGCTGG + Intergenic
1011913144 6:92467229-92467251 GTATAGGGCATGGCTGCCACAGG - Intergenic
1012441359 6:99264951-99264973 GTATAGGGGTTGGGTACAACTGG + Intergenic
1012589119 6:100958025-100958047 GTATTGGGATTTGGTACCACAGG - Intergenic
1013834327 6:114315101-114315123 GTATGTGGCTTGGGTAACACAGG + Intronic
1013907663 6:115237293-115237315 GTATAGGGGTTGGGTACAACTGG + Intergenic
1014198451 6:118583863-118583885 GTATAGGGATTAGGGACCACTGG - Intronic
1015336699 6:132047218-132047240 GTATTTGGCTTAGGCACAACAGG + Intergenic
1015865322 6:137721498-137721520 GTATAAGGGTTAGGTACAGCTGG + Intergenic
1016184205 6:141180011-141180033 ATATAGGGGTTTGGTACAACTGG - Intergenic
1016343088 6:143083522-143083544 GTATAAGGGTTAGGTACAGCTGG + Intronic
1017101140 6:150850902-150850924 GTATAGGGTTTGGGTACAACTGG - Intergenic
1017561786 6:155636149-155636171 GTATAGGACTTGTGTTCAAGAGG + Intergenic
1018761206 6:166895701-166895723 GTATAAGGGTTAGGTACAGCTGG - Intronic
1021356407 7:19657171-19657193 GTATAGGGGTTGGGTACAACTGG + Intergenic
1021756540 7:23858245-23858267 GTATAGGGGTTGGGTACAATTGG + Intergenic
1023396795 7:39759053-39759075 GTATAAGGATTGGGAACAACAGG - Intergenic
1024870600 7:53958853-53958875 GTATAGGGGTTGGGTACAACTGG + Intergenic
1025875880 7:65479247-65479269 GTATAGGGGTTAGGGACTACAGG - Intergenic
1028251500 7:88544077-88544099 GTATAGCGATTAGGTACTACTGG + Intergenic
1030337458 7:108341897-108341919 GTATAAGGGTTAGGTACAGCTGG - Intronic
1031417137 7:121508029-121508051 GTGTAAGGATTGGGGACAACAGG + Intergenic
1031731965 7:125311681-125311703 GTATAGAGGTTGTGTACAACTGG - Intergenic
1033759055 7:144421065-144421087 GTATAGGGGTTGGGTACAACTGG + Intergenic
1034334291 7:150310523-150310545 GTATAGGGGTTTGACACAACAGG - Intronic
1034579792 7:152032420-152032442 GTATAGGGGTTGGGTACAACTGG + Intronic
1037528401 8:19750171-19750193 GAATAAGGTTTGGGTACAAGGGG - Intronic
1038430601 8:27496534-27496556 GTATAGGGGTTGGGTATAGCTGG + Intronic
1038638971 8:29308827-29308849 GTATAGGGGTTGGGTACAACTGG - Intergenic
1039276180 8:35935846-35935868 GTATAGGGGTTTGGTACAACTGG - Intergenic
1039692999 8:39881639-39881661 ATATAGGGGTTCGGTACAACTGG + Intergenic
1039999503 8:42564297-42564319 GTATAGGGGTTGGGTACAACTGG + Intergenic
1040667692 8:49653156-49653178 GTATAGGGGTTGGGTACAACTGG + Intergenic
1040796648 8:51295417-51295439 GTATAGGGGTTAAGTACAACTGG + Intergenic
1040964881 8:53073237-53073259 GTATAGGGGTTGGGTACAACTGG + Intergenic
1040971281 8:53139722-53139744 GTATAGGGGTTGGGTACAATTGG + Intergenic
1042772094 8:72391806-72391828 GTATAGTGGTTAGGTACAACTGG - Intergenic
1042919792 8:73909859-73909881 GTATAGGGGTTGGGTACAGCTGG - Intergenic
1043257236 8:78151426-78151448 GTATAGGGGTTGGGTACAACTGG - Intergenic
1044005251 8:86930660-86930682 GTATAGAGGTTGGTTACAGCTGG + Intronic
1044456454 8:92397031-92397053 GTATAGGGGTTGGGTACAACTGG + Intergenic
1045929135 8:107602905-107602927 GTATAGGGGTTGGGTACAGCAGG + Intergenic
1046559433 8:115817773-115817795 GTATATGGCTTTGGCACCACGGG - Intergenic
1047807926 8:128378719-128378741 GTATAAGGATTAGGTACAACCGG + Intergenic
1047856532 8:128917587-128917609 GTATATGGGTTGGGCACCACAGG - Intergenic
1050194418 9:3065958-3065980 GTATAAGACTGGGGTACAAATGG - Intergenic
1051394222 9:16601810-16601832 GTAGAGAGATTGCGTACAACTGG + Intronic
1051935448 9:22438402-22438424 GTATAGGGGTTGGGTACAACTGG - Intergenic
1052057597 9:23922015-23922037 GTATAGGGGTTGGGTACAACTGG + Intergenic
1052182734 9:25550160-25550182 ATATGGGGGTTTGGTACAACTGG + Intergenic
1052289681 9:26827215-26827237 GTATAGGGGTTGGGTACAACTGG - Intergenic
1053140362 9:35679000-35679022 GTACAGGGCTTTGGAGCAACTGG - Intronic
1054858992 9:69930550-69930572 GTGTATGGGTTGGGGACAACAGG + Intergenic
1056392601 9:86153422-86153444 GTATAGGGGATGGGTACAACTGG + Intergenic
1060678070 9:125534885-125534907 GTATAGGGCCTGGGTGCACATGG - Intronic
1061280271 9:129594081-129594103 GTATAGGGATTAGGAACGACTGG + Intergenic
1187129138 X:16484198-16484220 GAACAGGGCTTGGGTGCAGCAGG - Intergenic
1187570996 X:20501757-20501779 ATATATTTCTTGGGTACAACAGG + Intergenic
1188097705 X:26043974-26043996 GTATAGGGGTTGGTTACAACTGG - Intergenic
1188136695 X:26501327-26501349 GTATAGGGGTTGGGTACAACTGG - Intergenic
1188765693 X:34088518-34088540 GTATATGGATTGGGAACCACCGG - Intergenic
1189032962 X:37468389-37468411 GTATAGGGATTAGGTACCATAGG - Intronic
1189613987 X:42765765-42765787 GTGTAGGGGTTTGGGACAACAGG - Intergenic
1191641313 X:63431708-63431730 GTATAGGGGTTGGGGGCCACTGG + Intergenic
1192482578 X:71498351-71498373 GTATAGGGGTTGGGTACAACTGG + Intronic
1195439748 X:104886611-104886633 GTATAGGGGTTGGGTACAACTGG - Intronic
1195535112 X:106001548-106001570 GTATAAGGGTTAGGTACAGCTGG - Intergenic
1196127177 X:112112938-112112960 GTATAGGGGTTGGGTACAACTGG + Intergenic
1196527186 X:116740455-116740477 GTATAAGGGTTAGGTACAGCTGG + Intergenic
1196527348 X:116741543-116741565 GTATAAGGGTTAGGTACAGCTGG - Intergenic
1197355824 X:125436744-125436766 GTATAGGGATTAGGTACTACTGG + Intergenic
1197513584 X:127398871-127398893 ATATAGGGGTTGGGTACAACTGG - Intergenic
1199832228 X:151558359-151558381 GTATAGGGATTGGGTACAACTGG + Intergenic
1200776379 Y:7173645-7173667 GTATAGGGGTTGGGAACAACTGG - Intergenic
1200800850 Y:7386033-7386055 GTATAGGGGTTGGGTATAACTGG + Intergenic
1200875238 Y:8147438-8147460 TTACAAGGCTTGGGGACAACTGG + Intergenic
1200880643 Y:8208546-8208568 ATATAGGGGTGGGGTACAACTGG + Intergenic
1200959470 Y:8983729-8983751 TTATAGAGTTTGGGTACAACTGG - Intergenic
1201311887 Y:12604864-12604886 GTATAGCACTTGGGTACAACTGG + Intergenic
1201429858 Y:13892783-13892805 ATATAGGGGTTTGGTACAACTGG - Intergenic
1201455289 Y:14162091-14162113 ATATAGGGGCTGGGTACAACTGG - Intergenic
1201473016 Y:14354068-14354090 GTATAGGGGTTGGGTACAGCTGG + Intergenic
1201487745 Y:14510176-14510198 GTATAGGGGTTGGGTACAACTGG - Intergenic
1201515808 Y:14817869-14817891 GTATAGGTCTTGGGTGCACCTGG + Intronic
1201555912 Y:15264567-15264589 GTATAGGGGTTTGGTACAACTGG - Intergenic
1201631420 Y:16075112-16075134 ATATAGGGGTTTTGTACAACTGG - Intergenic
1201640090 Y:16169007-16169029 GTATAGGGGTTGGGTACAGCTGG + Intergenic
1201662723 Y:16416318-16416340 GTATAGGGGTTGGGTACAGCTGG - Intergenic
1201729428 Y:17188777-17188799 GTATAGGTGTTGGGTGCAACTGG + Intergenic
1201743835 Y:17350087-17350109 GTATAGGGGTTTGGTACAACTGG + Intergenic
1201905735 Y:19084187-19084209 GTATAAGGTTTAGGTACAGCTGG - Intergenic
1201981528 Y:19914943-19914965 GTATAGGGGTTGGGTACGGCAGG + Intergenic
1202192439 Y:22259043-22259065 GTATACGGTTTTGGTACAACTGG + Intergenic
1202243052 Y:22790007-22790029 GTATAGGGTTTGGGTACAACCGG - Intergenic
1202258047 Y:22941163-22941185 GTATAGGGGTTGGGTACAACTGG - Intergenic
1202271871 Y:23081070-23081092 GTATCGGGGTTGGGTACAACTGG + Intergenic
1202294155 Y:23339612-23339634 GTATCGGGGTTGGGTACAACTGG - Intergenic
1202396039 Y:24423757-24423779 GTATAGGGTTTGGGTACAACCGG - Intergenic
1202411037 Y:24574921-24574943 GTATAGGGGTTGGGTACAACTGG - Intergenic
1202424868 Y:24714814-24714836 GTATCGGGGTTGGGTACAACTGG + Intergenic
1202445921 Y:24955271-24955293 GTATCGGGGTTGGGTACAACTGG - Intergenic
1202459744 Y:25095151-25095173 GTATAGGGGTTGGGTACAACTGG + Intergenic
1202474746 Y:25246335-25246357 GTATAGGGTTTGGGTACAACCGG + Intergenic