ID: 1091579578

View in Genome Browser
Species Human (GRCh38)
Location 12:1775460-1775482
Sequence AATTTCAGAGTGATTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091579578 Original CRISPR AATTTCAGAGTGATTTTCCC TGG (reversed) Intronic
902646615 1:17804118-17804140 AAGTTCACAGTGATGTGCCCTGG + Intronic
903033732 1:20481224-20481246 AATGCCAGATTGATTTTCCCAGG - Intergenic
904744044 1:32700251-32700273 AATATCAGAGTGAGTTTGGCTGG - Intronic
906064087 1:42967778-42967800 AGTTTCAGAGTGATTTGCCCAGG + Intergenic
906778455 1:48550847-48550869 AATTTCAGAGTGCTTTTTGCTGG + Intronic
908475275 1:64481389-64481411 AAATTCAGATTCATTTTCACTGG - Intronic
908556164 1:65258507-65258529 AATTTCAGAGTCATTCTCTTTGG - Intronic
910243867 1:85118520-85118542 AAATACAGAGTATTTTTCCCAGG + Intronic
910763534 1:90758512-90758534 AATCTCAGAGTCTTTTTCCTGGG - Intergenic
917250332 1:173052726-173052748 AATTTTTGAGGGAATTTCCCTGG + Intergenic
917410474 1:174755497-174755519 AATGACAGAGTGTTTTTCTCTGG + Intronic
917925798 1:179788224-179788246 AGTTTCAGAATGATTTCCCTTGG - Intronic
918548707 1:185714941-185714963 ATTTTTAGAGTGAGTATCCCTGG + Intergenic
920254018 1:204642144-204642166 ATTTTCACAGCCATTTTCCCAGG + Intronic
921660804 1:217799882-217799904 AATTTCAGAATATTTTTCTCAGG + Intronic
923252578 1:232191328-232191350 AGTTTCAGAGTGCCTCTCCCTGG - Intergenic
923918975 1:238542578-238542600 AATATGAGAGGGAGTTTCCCAGG + Intergenic
924877016 1:248116721-248116743 TATTTCAGATGGCTTTTCCCAGG - Intergenic
1063510290 10:6638123-6638145 GATTGCAGAATAATTTTCCCAGG + Intergenic
1063551478 10:7038020-7038042 ATTTTCAGAGTAAGTTTCCCAGG - Intergenic
1063934986 10:11068099-11068121 AAATTTAGACTCATTTTCCCAGG + Intronic
1064835432 10:19523371-19523393 AATTTCAGATCTATTTTACCTGG - Intronic
1065802838 10:29367916-29367938 AATTTCAAAGTGATTGTAACAGG - Intergenic
1067321834 10:45228437-45228459 AATTTCAGAGAAATTATTCCTGG - Intergenic
1068802466 10:61157725-61157747 ATTTTCAGGCTAATTTTCCCAGG - Intergenic
1070907894 10:80090400-80090422 AGATTCTGAGTGATTTGCCCAGG + Intronic
1071795192 10:88997345-88997367 AATTTCAGATGGAATTTCCTAGG + Intronic
1072332850 10:94370459-94370481 AATTTTAGAGGGATTTTCCTAGG + Intergenic
1074730521 10:116368546-116368568 AATTTCAGAGGGATTGCCTCTGG - Intronic
1076030599 10:127154655-127154677 AACTTCTGAGTTACTTTCCCTGG + Intronic
1078236527 11:9490228-9490250 AAGTTAACAGTGATTTTCCCTGG + Intronic
1078407923 11:11087314-11087336 AAATTCAGAGTGATTTTCACAGG - Intergenic
1079057178 11:17216359-17216381 AATTTCAGAATGATTGACCTAGG - Intronic
1080570571 11:33552974-33552996 CATTTCCCAGGGATTTTCCCTGG - Intronic
1081495537 11:43606310-43606332 ACTTTAGGAGTGATGTTCCCAGG - Intronic
1082898786 11:58222646-58222668 ATGTTCACAGTGAGTTTCCCAGG - Intergenic
1083976444 11:66125522-66125544 GGATTCAGAGTGATTTTCCAGGG + Intronic
1085734577 11:79028330-79028352 CATTTCAGAGTTTATTTCCCAGG - Intronic
1088091484 11:106045406-106045428 ATTTTTAGAGTTATTTTCACTGG + Intergenic
1091232319 11:133996716-133996738 AATTTAAGAAGGATATTCCCAGG + Intergenic
1091579578 12:1775460-1775482 AATTTCAGAGTGATTTTCCCTGG - Intronic
1092969830 12:13682854-13682876 AATTTCAGAGAGCTATTACCTGG + Intronic
1094099774 12:26749550-26749572 AATTTCAGGGTGATGATCACAGG + Intronic
1095691749 12:45097336-45097358 AAATTCTGAGTTATTTTCCTTGG + Intergenic
1097732325 12:63142930-63142952 AATTTCAGTGTGTTTTTTCCTGG - Exonic
1097957854 12:65504992-65505014 ATATTCACAGTGATTTTCTCTGG - Intergenic
1098256637 12:68623399-68623421 AATTCAAGAGTGTTTTGCCCTGG + Intronic
1098594974 12:72261814-72261836 AAATTCAAAGTGCTTTTCCATGG + Intronic
1101290536 12:103363000-103363022 CTTTTCACAGTGAATTTCCCAGG - Intronic
1102838639 12:116093134-116093156 AATTTCCAAATGATTTTCACCGG + Intronic
1103082883 12:118039368-118039390 AATTAGAGAGAGATTTTCCATGG + Intronic
1104241070 12:126990116-126990138 AATTCCAGATTGAATTTCCCAGG - Intergenic
1104319904 12:127741342-127741364 AGGCTCAGAGTGATTTTCCCAGG + Intergenic
1104568005 12:129902842-129902864 AATTTGGGATTGACTTTCCCTGG - Intronic
1105061702 12:133158408-133158430 TATTTGTCAGTGATTTTCCCAGG - Exonic
1105982527 13:25533567-25533589 AATTTGAGAAATATTTTCCCTGG + Intronic
1106282229 13:28285478-28285500 AAATTCACAGTGATGTTCCTTGG + Intronic
1106418332 13:29564725-29564747 AGATTCAGAGTAATTTGCCCAGG - Intronic
1106493223 13:30248594-30248616 TATCTCATTGTGATTTTCCCAGG - Intronic
1106717645 13:32407748-32407770 AATTGCAGCATGACTTTCCCAGG - Exonic
1108136059 13:47362226-47362248 AATTTCAGTGTCATTTTTCAGGG + Intergenic
1109336958 13:61006258-61006280 AATTTAAGAGTGATTCTGCAGGG + Intergenic
1109743928 13:66595153-66595175 CATTTCAAAGAGATGTTCCCAGG - Intronic
1109954767 13:69551223-69551245 AATTGCAAAGTGATTTTCCAAGG - Intergenic
1111595075 13:90401237-90401259 AATTGCAGAGTTGTCTTCCCTGG + Intergenic
1111838824 13:93424091-93424113 TGTCTCAGAGTGTTTTTCCCAGG - Intronic
1111843458 13:93478620-93478642 AATTTCAGAGTGAGATCACCTGG + Intronic
1112105324 13:96233695-96233717 AATTTCTGAGTGAAGCTCCCAGG - Intronic
1112730338 13:102353541-102353563 AATTACAGCGTGATTGTACCAGG - Intronic
1114624292 14:24118627-24118649 ACTTTGGGAGTGATTTTCCCAGG - Intronic
1116591414 14:46780875-46780897 CATATCAGAGTGCTTTTGCCTGG + Intergenic
1120052815 14:79887652-79887674 AATTGCAGAGTGATCTCACCCGG - Intergenic
1120481884 14:85060134-85060156 AATTTCAAAGTGATGTTCTTAGG + Intergenic
1120616776 14:86716066-86716088 AATTTCTGAGTGAAGTTCACTGG - Intergenic
1122490464 14:102111984-102112006 AATTTCAAAGTGATGTACCTTGG + Intronic
1123451658 15:20368177-20368199 AAATTCAGAGAGAAGTTCCCAGG + Intergenic
1123474352 15:20579325-20579347 AATTTCCTAGTCAGTTTCCCTGG + Intergenic
1123643659 15:22421028-22421050 AATTTCATAGTCAGTTTCCCTGG - Intergenic
1123722329 15:23070197-23070219 AATTTCATAGTCAGTTTCCCTGG - Intergenic
1123734655 15:23174339-23174361 AATTTCATAGTCAGTTTCCCTGG + Intergenic
1123752826 15:23371985-23372007 AATTTCATAGTCCGTTTCCCTGG + Intergenic
1124285158 15:28395646-28395668 AATTTCATAGTCAGTTTCCCTGG + Intergenic
1124297538 15:28515968-28515990 AATTTCATAGTCAGTTTCCCTGG - Intergenic
1124322840 15:28727779-28727801 AATTTCATAGTCAGTTTCTCTGG - Intronic
1124523765 15:30428339-30428361 AATTTCATAGTCAGTTTCCCTGG - Intergenic
1124534902 15:30537876-30537898 AATTTCATAGTCAGTTTCCCTGG + Intergenic
1124546510 15:30632458-30632480 AATTGCAAAGTCATATTCCCAGG + Intronic
1124574359 15:30895141-30895163 AATTTCATAGTCAGTTTCCGTGG + Intergenic
1124763747 15:32469731-32469753 AATTTCATAGTCAGTTTCCCTGG - Intergenic
1124774881 15:32579320-32579342 AATTTCATAGTCAGTTTCCCTGG + Intergenic
1124780112 15:32622459-32622481 AATTGCAAAGTCATATTCCCAGG + Intronic
1125275508 15:37985324-37985346 AAAATTAGAATGATTTTCCCTGG + Intergenic
1125285513 15:38088496-38088518 AATTTCATAGTCAATTTTCCAGG + Intergenic
1126551491 15:49935652-49935674 AGTTTGAGAGTAATTTTCTCTGG - Intronic
1127974000 15:63983837-63983859 AAATTCAGAGTGATTCTGCCAGG + Intronic
1128518222 15:68357359-68357381 AATTTGAGAGTGAGGATCCCCGG + Intronic
1130809400 15:87360597-87360619 AATTTCAGGATGATATTCCAGGG + Intergenic
1131896300 15:97034430-97034452 TATTTCTGACTGATATTCCCTGG - Intergenic
1134028331 16:10971856-10971878 AATTCCTGGGTTATTTTCCCCGG + Intronic
1137458969 16:48640516-48640538 AATTTCCCAGTGATCTTACCAGG - Intergenic
1138811210 16:60152883-60152905 AATTTCAAAGTCATGTGCCCTGG - Intergenic
1139610372 16:68052575-68052597 AACTTCAGAGTGATGTTTTCTGG + Intronic
1139669153 16:68479982-68480004 GGTTTCAGTGTGATTTGCCCAGG + Intergenic
1142937300 17:3345873-3345895 AATTTCACAGTGATTGTCTTGGG - Intergenic
1143989221 17:10942483-10942505 AATTTCAGAGGGATTGTTGCTGG + Intergenic
1144525980 17:15990250-15990272 AATTTAAGAGTGATTATTACTGG + Intronic
1146410527 17:32579774-32579796 AATTTCAAAATAATTTTGCCTGG - Intronic
1148028879 17:44606607-44606629 AACTTCAGAGAGGATTTCCCTGG - Intergenic
1148194237 17:45701728-45701750 CATTTCAGAGTCTGTTTCCCAGG + Intergenic
1148397388 17:47320604-47320626 AATTCCAGAGTTATTTTTCATGG + Intronic
1148917894 17:50998700-50998722 AATTTCAGAGTACTTTTACAAGG + Intronic
1149552758 17:57552262-57552284 AAGTTCAGAGTGATGTTCACTGG + Intronic
1150475259 17:65470228-65470250 AATTTAAGAGTGGCTTTCCTGGG - Intergenic
1150984610 17:70181724-70181746 AATTTCAGAGTCCTTTTGCTTGG + Intergenic
1153848579 18:9071829-9071851 AATGTCAGAGTGCTTCTCACAGG - Intergenic
1153972062 18:10235942-10235964 AATTTCAGAATGATTGCCCCCGG + Intergenic
1154086675 18:11312393-11312415 AATTTAAAAATGTTTTTCCCAGG - Intergenic
1154342162 18:13512671-13512693 AATTAGAGATTGATTTTTCCAGG + Intronic
1155841661 18:30652477-30652499 AATGCCAGAGTGAGTTTCCTAGG + Intergenic
1156177827 18:34568327-34568349 AATTTGAGAGAGATTTTTACTGG + Intronic
1156830150 18:41482218-41482240 AAGTTTATAGTCATTTTCCCGGG - Intergenic
1156992429 18:43425720-43425742 AATGTCAGAGGGATCTTCCTAGG - Intergenic
1159093681 18:63877304-63877326 AATTTCACAGTGATGTGCCTTGG - Intronic
1159174075 18:64811857-64811879 AATTTCAGAGCCAGTCTCCCTGG + Intergenic
1159414330 18:68124741-68124763 ATTTTCAGAGAGGTTTTCTCTGG - Intergenic
1163262043 19:16197187-16197209 AATACCAGAGTGATTTACCCAGG - Intergenic
1163959442 19:20674587-20674609 AATTTCATAGTAATTTTCTTTGG - Intronic
925134190 2:1515074-1515096 AATTCCAGAATGAATTTCCACGG + Intronic
927136609 2:20101311-20101333 CCTTTCAGAGAGACTTTCCCTGG + Intergenic
927175840 2:20406821-20406843 AATTTCAGAGTGACTCTCATTGG + Intergenic
927456075 2:23250453-23250475 AATTTCAGGGTGAATTTTACTGG - Intergenic
927480494 2:23450111-23450133 AATTGCAGACTTGTTTTCCCCGG - Intronic
928138388 2:28706227-28706249 GATTTCAGTTTGCTTTTCCCTGG - Intergenic
928610813 2:32990555-32990577 GATTTCAGAGTGACTGTACCTGG + Intronic
929486355 2:42358552-42358574 AATTTCTGAGTGATTGTGACAGG - Intronic
929840713 2:45459867-45459889 AATTTCAGAAACATTTTCACTGG - Intronic
929943220 2:46351049-46351071 ACTTTCAGACTTCTTTTCCCAGG + Intronic
930954571 2:57190181-57190203 AATTTCACAGTGGTGTTCACAGG - Intergenic
931856945 2:66312652-66312674 AATTTCATAATGATGTGCCCAGG - Intergenic
932897260 2:75652726-75652748 AATTTCAGATTTCTTATCCCAGG - Intronic
933254147 2:80061109-80061131 TATTTCAGAGTATGTTTCCCAGG + Intronic
934584148 2:95474924-95474946 AATTTCAGAGTGATTCTGGCAGG + Intergenic
934595304 2:95601790-95601812 AATTTCAGAGTGATTCTGGCAGG - Intergenic
934787468 2:97023744-97023766 AATTTCAGAGTGATTCTGGCAGG + Intergenic
935715965 2:105939253-105939275 ATCTTCAGAGTAATTTTACCTGG - Intergenic
936269617 2:111039675-111039697 AACTTCTGAGTGATTTTCAGGGG - Intronic
937111276 2:119368374-119368396 AGTTTGAGAGTGAAGTTCCCAGG - Intronic
937775456 2:125770428-125770450 TGTTTCAGAGTGATTTTCTCTGG + Intergenic
938162729 2:129000960-129000982 AATTTCATGGTGATGTGCCCTGG + Intergenic
939329163 2:140735889-140735911 AATTGCAGGGTTTTTTTCCCTGG - Intronic
940196213 2:151097146-151097168 AATTTCAGATAGAGTTTCACTGG - Intergenic
940877499 2:158912684-158912706 AATTTTATAGTGATGTGCCCTGG + Intergenic
941841806 2:170093227-170093249 GATTTCAGTGAGATTTTCCCAGG - Intergenic
943140980 2:183980814-183980836 AATTTCAGAATGACTTTTCTTGG + Intergenic
943884218 2:193192834-193192856 AATTTCAGAGACATTATCCTAGG - Intergenic
944736489 2:202571549-202571571 AATTTCTGAGTGACTTACCCAGG - Intergenic
945285052 2:208073826-208073848 AAGTTAATAGTGATTTTCCTTGG + Intergenic
947053752 2:226076599-226076621 TATTTGAGTGTGATTTTCCTGGG + Intergenic
1169971806 20:11276808-11276830 AATGTCAAAGAGCTTTTCCCAGG - Intergenic
1170143406 20:13147622-13147644 AATATCAATTTGATTTTCCCTGG + Intronic
1170602392 20:17850638-17850660 AATTTCATAGGAATTTTTCCAGG - Intergenic
1173050544 20:39555829-39555851 AAATTCAGAATAATTTTACCAGG - Intergenic
1173238785 20:41274619-41274641 AACTCCACAGTGATTTTTCCTGG - Intronic
1174792311 20:53490845-53490867 AATTTCACTGTTATTTTCCAGGG + Exonic
1177079331 21:16619024-16619046 AATTTCTGAGTGAATTTACTTGG + Intergenic
1177732562 21:25046917-25046939 AATTTCACAGTGAGTTACTCAGG - Intergenic
1178031313 21:28529513-28529535 AATTTCCCAGTGGTTTTCCTTGG - Intergenic
1182018775 22:27063401-27063423 AAGTTTTCAGTGATTTTCCCAGG + Intergenic
1182344722 22:29654013-29654035 AATTTCCAAGTCATTGTCCCCGG + Intronic
1182756695 22:32686034-32686056 AATTTCATGGCGATTTTCTCTGG + Intronic
1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG + Intergenic
949202896 3:1401511-1401533 AACTTCAGACTCATTTTCCATGG - Exonic
949732161 3:7126093-7126115 ATTTCCAGTGTGATTTTCCCTGG - Intronic
950344671 3:12282126-12282148 AATTTCAGAGAGATTTCACTTGG - Intergenic
951064762 3:18250866-18250888 AATCTCATGGTGATTTCCCCCGG + Intronic
951312549 3:21146189-21146211 TTTTTCAGTGTGATTTTCCTGGG + Intergenic
952110676 3:30120949-30120971 AATTTCAGTGTGGCTTGCCCTGG - Intergenic
952410664 3:33047148-33047170 AATCTCAGAGTCTGTTTCCCTGG + Intronic
952509956 3:34043087-34043109 AGTTTCAGAGTCAGCTTCCCAGG - Intergenic
953300475 3:41770228-41770250 AATTTCATAGTGATCTTCCACGG + Intronic
953474041 3:43191080-43191102 AATGTCACAGTGGTTTTCACTGG + Intergenic
953586886 3:44209730-44209752 CAGCTCAGCGTGATTTTCCCAGG - Intergenic
953668321 3:44942008-44942030 GGTTTCAGAGTGCTTCTCCCAGG + Intronic
955406043 3:58626479-58626501 ATTTTCACAATGATTTTCCAAGG + Intronic
956436488 3:69239070-69239092 ACTTTCAAAGTTCTTTTCCCAGG - Intronic
956961843 3:74412170-74412192 TATTTCAGATCGATTTTACCTGG - Intronic
958169775 3:89924209-89924231 GATTTCAGCATGATTTTACCAGG - Intergenic
958617012 3:96506956-96506978 AATTTCCGAGTGAATTTGTCTGG + Intergenic
958925793 3:100155954-100155976 AATTTCACAGTGATGCTCCTTGG + Intronic
960135687 3:114102688-114102710 TTTCTCAGAGTGATCTTCCCTGG + Intergenic
960392493 3:117095319-117095341 AATTAAACAGTGATTTTCCAGGG + Intronic
960663478 3:120086842-120086864 ATTATCAGAATGATTTACCCTGG + Intronic
961546452 3:127637292-127637314 AATATCAGAGTGATTCTACATGG - Intronic
964527019 3:157625817-157625839 AAAGTAAGAGTAATTTTCCCTGG - Intronic
965247543 3:166292711-166292733 AATTTGATATTTATTTTCCCTGG - Intergenic
965932536 3:174063248-174063270 ATTTTGAGAGTTATTTTCCTTGG - Intronic
966769959 3:183494755-183494777 GATTTCTTAGTGATTTTTCCAGG - Intronic
971441506 4:26692524-26692546 AATCTCTGAGTCATTTGCCCTGG - Intronic
973954798 4:56051684-56051706 AATTCCAGCGTGATTTTCTGGGG - Intergenic
976901132 4:90177629-90177651 AACATCAGAGTGATTTTTTCTGG - Intronic
976911333 4:90310017-90310039 AATTTTATAGTGATTTTAGCTGG - Intronic
977091646 4:92684250-92684272 AAGTGCAGAGTGATTATCCTTGG + Intronic
977207052 4:94174866-94174888 AATTTCAGACTTAATTTCCATGG - Intergenic
977711042 4:100125914-100125936 AATCTAAGAGTGAATTTCTCAGG + Intergenic
978561402 4:110037529-110037551 AATTTCATATTGCTTCTCCCAGG - Intergenic
979388358 4:120097499-120097521 GACTTCAAAGAGATTTTCCCTGG - Intergenic
979632067 4:122914373-122914395 AATTTAAGAGTAAGTTTCCTTGG - Intronic
980000280 4:127479138-127479160 TATTTCAGTGAGATTTTCTCTGG - Intergenic
980080543 4:128339643-128339665 AATTTCAGAGCTTTTTTCCTAGG + Intergenic
980567156 4:134558405-134558427 AATTTCAAAGTGATTATTCATGG - Intergenic
981023696 4:140054577-140054599 AATATGAGTGTGATTTTGCCAGG - Intronic
981349296 4:143710316-143710338 AATTTCAGTGTTAGTTTCCCTGG + Intergenic
981640781 4:146941322-146941344 GATTTTATTGTGATTTTCCCTGG - Intronic
981640816 4:146941772-146941794 AAACTCAGAGTGATTTTTTCAGG - Intronic
981851988 4:149242020-149242042 AATTTCTGAGGGAGGTTCCCAGG - Intergenic
982778066 4:159462406-159462428 AATTCAACAGTGATTTTTCCTGG + Intergenic
983287479 4:165758120-165758142 AATCTCAGAATGACTTTCACTGG + Intergenic
984438707 4:179737758-179737780 CATTTAAGAATGATTTTCCAAGG - Intergenic
984564374 4:181310060-181310082 AATTACTGAGTGCTTTTCACAGG - Intergenic
984804964 4:183743641-183743663 CATCTCTGAGTGATTTTCCTAGG + Intergenic
985216590 4:187659699-187659721 ATTTTGAAAGTAATTTTCCCAGG - Intergenic
985905901 5:2836304-2836326 AAAGACAGAGTGCTTTTCCCCGG + Intergenic
986672621 5:10156612-10156634 GATTGCAGAGGGATTTTCCTGGG - Intergenic
987770392 5:22294910-22294932 CATTTCATAGGGATTCTCCCAGG - Intronic
987814489 5:22882699-22882721 TTTTTCAGACTGATTTCCCCAGG - Intergenic
989295160 5:39817087-39817109 CAAGTCAGAGTTATTTTCCCCGG - Intergenic
989374063 5:40741428-40741450 AACTTCTCAGTCATTTTCCCTGG + Intronic
990032011 5:51273008-51273030 AAAATCATAGTGATTTTCTCTGG - Intergenic
991727469 5:69550075-69550097 AATTTAAGAGTCATTTTCTATGG + Intronic
991867488 5:71077801-71077823 AATTTAAGAGTCATTTTCTATGG - Intergenic
991985365 5:72280221-72280243 AATTTCAGGGTCATCTTCTCAGG + Intronic
992345503 5:75872390-75872412 AATTTCAGAATCATTTTGCCTGG - Intergenic
992633294 5:78702272-78702294 AATTTAAGAGTATTTTCCCCTGG - Intronic
994834560 5:104832692-104832714 TATTTAAGAGTGATTATCCTAGG + Intergenic
995801271 5:115998267-115998289 AATTTAATAGTGATTATCTCAGG - Intronic
996672217 5:126131801-126131823 AATTTCACAGTGAAATGCCCTGG - Intergenic
996878441 5:128265931-128265953 CATTTCAGACAGATTTCCCCCGG - Intronic
997198653 5:131996296-131996318 TTCTCCAGAGTGATTTTCCCTGG - Intronic
997358806 5:133281316-133281338 TATTTCAGAGATATTTTCCTAGG - Intronic
997622452 5:135307698-135307720 GGTTTCAGGGAGATTTTCCCTGG + Intronic
998524010 5:142826033-142826055 AAGCACAGAGTAATTTTCCCTGG - Intronic
998824696 5:146089394-146089416 AAGTGCAGAGTGATTTTAACAGG - Intronic
999097099 5:148989531-148989553 TCCTTCAGAGTGATTTTCCAAGG - Intronic
999145788 5:149392589-149392611 AAATTTAGAGTGATTTTCTCTGG + Intronic
999870841 5:155748957-155748979 CATTTGAGAATGATTTTCTCAGG + Intergenic
1000664395 5:163977086-163977108 AATTTCAAAGTGTTTTTCATAGG - Intergenic
1000737191 5:164919498-164919520 AATTCTAGACTGATTTTTCCAGG + Intergenic
1004473798 6:15952551-15952573 GATTTCAGGGTCATTTTCTCAGG - Intergenic
1004672623 6:17812061-17812083 AATTCCAGATTGATTTTCTTTGG - Intronic
1004941249 6:20558595-20558617 GATTACAAAGTGATTTTTCCTGG - Intronic
1005017030 6:21384191-21384213 AATTTCAGAATAATTTCCCTAGG - Intergenic
1007646625 6:43387211-43387233 ATTTTGAAAGTAATTTTCCCAGG + Intergenic
1008832350 6:55780933-55780955 CATTTCAGAGTGATGTCCCATGG - Intronic
1009640451 6:66328704-66328726 AATTTCAGTGTTATCTTTCCAGG - Intergenic
1010180501 6:73081388-73081410 AATTTAAGAATGGGTTTCCCTGG + Intronic
1013745901 6:113345631-113345653 AATTATAGAATGATTTTTCCAGG + Intergenic
1014348971 6:120314986-120315008 AATTTCAAAGAGATACTCCCGGG + Intergenic
1015463840 6:133525112-133525134 AAGTTCAGAGTGAAGTTACCTGG - Intronic
1015705153 6:136079929-136079951 ATATTTGGAGTGATTTTCCCAGG - Intronic
1016099931 6:140086674-140086696 AATTTCAGATTGGTTTGCCATGG + Intergenic
1016186733 6:141206688-141206710 AAATTCAGAGTGAATGTCACTGG - Intergenic
1017238466 6:152141388-152141410 AATTACAAAGAGATTTTCCCCGG - Intronic
1017634278 6:156428459-156428481 ATTTTGTGACTGATTTTCCCTGG + Intergenic
1017993783 6:159512963-159512985 AATTTAAGAATGAATCTCCCAGG - Intergenic
1019839978 7:3431328-3431350 ATTTTCAGAGTGATTCTACCCGG - Intronic
1020287625 7:6697285-6697307 AACTTGGGAGTGTTTTTCCCAGG - Intronic
1021180800 7:17503596-17503618 ATTTTCAGATTCATCTTCCCTGG - Intergenic
1021296105 7:18907956-18907978 ATTTTTACAGTGATTTTTCCAGG + Intronic
1022118493 7:27283792-27283814 AATCTTAGAGTGATATTCCCAGG + Intergenic
1022279256 7:28889675-28889697 AATTTCAGAATGGTTAACCCGGG - Intergenic
1022369342 7:29756263-29756285 AAGTTCAGAGAGACTTTCTCAGG - Intergenic
1022877462 7:34549980-34550002 AATTTAAAAGTCATTTTCCAGGG - Intergenic
1023223336 7:37943790-37943812 CATTTCATAGTGATTGTTCCGGG + Intronic
1024428080 7:49252566-49252588 AATTTAAGTATGATTTTACCAGG + Intergenic
1024575314 7:50758837-50758859 AATTTCAGAATGTTATTGCCAGG + Intronic
1024830210 7:53444456-53444478 AATTTCTTAGTGGTTTTCCTGGG + Intergenic
1024885003 7:54130820-54130842 AGTTTCGTAGTGATTTTCCATGG + Intergenic
1024895191 7:54251904-54251926 AATTTCTAACTGATTTGCCCAGG + Intergenic
1025753510 7:64313156-64313178 AATTTGAGAGTGCTTGTGCCTGG - Intronic
1026823481 7:73565695-73565717 CACTTCAGTGTGATTCTCCCAGG - Intergenic
1027413481 7:77947631-77947653 AATTTCATATTGATTCTCCTGGG + Intronic
1027823492 7:83079575-83079597 GATTTTAGAGTTAATTTCCCAGG - Intronic
1028204734 7:88003516-88003538 AAATTCAGTGTGATTCTCTCAGG - Intronic
1028309822 7:89317382-89317404 AAATTGAGAGTGATTTCCTCTGG + Intronic
1029141716 7:98415746-98415768 AATTTCAGAATCATTTTTCAAGG + Intergenic
1033049923 7:137994844-137994866 AAATTCACAGTAATTTGCCCTGG - Intronic
1034085559 7:148319198-148319220 AATTACAGAGTGTATTTTCCAGG - Intronic
1035065007 7:156097939-156097961 AATTTCATCCTCATTTTCCCTGG + Intergenic
1035380461 7:158436848-158436870 AATTTTAGAGTGATGTTCAGAGG + Intronic
1035463028 7:159057152-159057174 ATTTTCAGATTCAATTTCCCTGG + Intronic
1036406389 8:8459279-8459301 AATATCAGTGAGAATTTCCCAGG + Intergenic
1037069614 8:14627661-14627683 AATTTCTGAATGATTGTCCTTGG + Intronic
1037209044 8:16362741-16362763 CATTAAAGAGTGAGTTTCCCAGG + Intronic
1039151897 8:34515795-34515817 AAATTCAGAGTTCCTTTCCCAGG - Intergenic
1039498153 8:37996867-37996889 AATTTCAGAGTGATTTGTAAAGG + Intergenic
1041109591 8:54472019-54472041 AATGTTTGAGTGCTTTTCCCTGG + Intergenic
1042256624 8:66810732-66810754 AATTTCAGAATGTTTTTCTCAGG - Intronic
1042816360 8:72881875-72881897 AAGTTCTGAGTGGTTTTCACTGG - Intronic
1044904423 8:96985436-96985458 ACTTTCTGTGTGATTTTCTCAGG + Intronic
1045640846 8:104248693-104248715 GCTTTCAGTCTGATTTTCCCTGG + Exonic
1045650375 8:104336703-104336725 CATTTCAGAGTGATGTTCCCAGG - Intronic
1045873641 8:106953668-106953690 AATTTAAAAGTGATCTGCCCTGG + Intergenic
1047769484 8:128019174-128019196 ATTTTCAGAGTTCTTTTCCTTGG - Intergenic
1048261340 8:132947892-132947914 AATTTGATAGTGATTTTAGCTGG - Intronic
1050326861 9:4506250-4506272 AATTTCATAGTAATTTGGCCGGG - Intronic
1050899584 9:10929466-10929488 AAATACAGAGTGATTGTCACTGG - Intergenic
1052165823 9:25326735-25326757 TTTTTCAGAGTGTTTTTCACAGG + Intergenic
1052699850 9:31924450-31924472 AATTTTAGAGTAAATTTCGCGGG + Intergenic
1053749942 9:41242914-41242936 AATTTCATATTGATTTTCATTGG - Intergenic
1054255442 9:62807251-62807273 AATTTCATATTGATTTTCATTGG - Intergenic
1054335862 9:63808355-63808377 AATTTCATATTGATTTTCATTGG + Intergenic
1055176894 9:73330130-73330152 AATTTCAAACTGATTTTGCAAGG - Intergenic
1055219337 9:73909314-73909336 AATATAAGAGTTATTTTCCATGG - Intergenic
1055715735 9:79115974-79115996 AAATTTAGAGTGATGTTCCCTGG - Intergenic
1056695114 9:88841989-88842011 AATTTTAGAATAATTTTGCCAGG + Intergenic
1057025252 9:91730265-91730287 AATGTCAAAGTGAATATCCCAGG + Intronic
1057323781 9:94040462-94040484 AATTCCAGATTAATTTCCCCTGG + Intronic
1058043777 9:100334202-100334224 AATTTCACAGTGATGTATCCAGG - Intronic
1058157317 9:101529879-101529901 ATTTTCAGAGAGCTTTCCCCCGG + Intronic
1058173898 9:101715516-101715538 AAATTAAGAGTGATTGTCTCTGG + Intronic
1058752172 9:108050371-108050393 GACTTAAGAGTGATGTTCCCTGG + Intergenic
1059032771 9:110717988-110718010 AAGTACAGAGTGACTTTCCCAGG + Intronic
1059287211 9:113184746-113184768 AATTTCAGTGTTATGTTGCCGGG + Exonic
1059499803 9:114742136-114742158 ACATTCAGAGTTATTTTTCCAGG - Intergenic
1059558500 9:115307269-115307291 ACTTTAATAATGATTTTCCCAGG - Intronic
1203444339 Un_GL000219v1:41434-41456 ACTTTGAGAGTGATATTTCCAGG + Intergenic
1186094832 X:6089017-6089039 AATTTGCCAATGATTTTCCCAGG - Intronic
1186777728 X:12882520-12882542 AATTTCACAGTCATTGTCTCAGG + Intronic
1187821308 X:23291014-23291036 AATTTCAGACAGGTTATCCCTGG + Intergenic
1187926451 X:24255000-24255022 AAGTTCAAAGATATTTTCCCTGG + Intergenic
1188027886 X:25230199-25230221 AATTTAACAGTGATTATCCCTGG - Intergenic
1188210030 X:27411662-27411684 AATTTCAATGCTATTTTCCCAGG - Intergenic
1189681570 X:43521841-43521863 AATTTCCCAGTGTTTCTCCCCGG + Intergenic
1192179063 X:68904314-68904336 AAGTTAACAGTGATTTTCCCTGG - Intergenic
1192268379 X:69555947-69555969 GATTTCAGTTTGATTTTCTCAGG - Intergenic
1192274799 X:69617243-69617265 AATTTGAGACTGATTGTCCTCGG + Intronic
1194029481 X:88794284-88794306 AATATCAGTGTCATTTTCCATGG + Intergenic
1194504938 X:94722876-94722898 AATTTGAGAGTGACTTACCTGGG - Intergenic
1194639157 X:96381808-96381830 AGTTTCAGAGTGATCTTGTCTGG + Intergenic
1194998004 X:100612807-100612829 TATTTCAAAGTGAAATTCCCTGG - Intergenic
1195933043 X:110098252-110098274 TATTTCTGAGTGGTTTTCCATGG + Intronic
1197657833 X:129136717-129136739 AATTCCAGAATGAATTTCACTGG - Intergenic
1198034070 X:132783660-132783682 AATTCCAGACTGAAATTCCCAGG - Intronic
1198984959 X:142440604-142440626 AATTTCTGTTGGATTTTCCCAGG - Intergenic
1199147218 X:144382184-144382206 AATAACAGAGTGATTTTCCATGG - Intergenic