ID: 1091582344

View in Genome Browser
Species Human (GRCh38)
Location 12:1797350-1797372
Sequence CCGCACTTCCGCCTTGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091582323_1091582344 25 Left 1091582323 12:1797302-1797324 CCCTCCTCCCGGCTGTGGAGCCG 0: 1
1: 0
2: 2
3: 17
4: 237
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582326_1091582344 18 Left 1091582326 12:1797309-1797331 CCCGGCTGTGGAGCCGTTTCCCG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582325_1091582344 21 Left 1091582325 12:1797306-1797328 CCTCCCGGCTGTGGAGCCGTTTC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582324_1091582344 24 Left 1091582324 12:1797303-1797325 CCTCCTCCCGGCTGTGGAGCCGT 0: 1
1: 0
2: 1
3: 11
4: 160
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582337_1091582344 -2 Left 1091582337 12:1797329-1797351 CCGGGGGTTCCGGGGCCCTGCCC 0: 1
1: 0
2: 1
3: 37
4: 443
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582336_1091582344 -1 Left 1091582336 12:1797328-1797350 CCCGGGGGTTCCGGGGCCCTGCC 0: 1
1: 0
2: 2
3: 45
4: 379
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582322_1091582344 26 Left 1091582322 12:1797301-1797323 CCCCTCCTCCCGGCTGTGGAGCC 0: 1
1: 0
2: 2
3: 22
4: 288
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582335_1091582344 5 Left 1091582335 12:1797322-1797344 CCGTTTCCCGGGGGTTCCGGGGC 0: 1
1: 0
2: 2
3: 12
4: 100
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149
1091582327_1091582344 17 Left 1091582327 12:1797310-1797332 CCGGCTGTGGAGCCGTTTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 82
Right 1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091582344 Original CRISPR CCGCACTTCCGCCTTGCCGA GGG Intronic