ID: 1091582715

View in Genome Browser
Species Human (GRCh38)
Location 12:1798855-1798877
Sequence GACTCACATCCGCGATCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091582715_1091582721 21 Left 1091582715 12:1798855-1798877 CCACCCGATCGCGGATGTGAGTC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1091582721 12:1798899-1798921 GCCCGAACTGCCCTGAGCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 220
1091582715_1091582726 29 Left 1091582715 12:1798855-1798877 CCACCCGATCGCGGATGTGAGTC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1091582726 12:1798907-1798929 TGCCCTGAGCCCAGGGGCAGAGG 0: 1
1: 0
2: 6
3: 95
4: 879
1091582715_1091582719 -9 Left 1091582715 12:1798855-1798877 CCACCCGATCGCGGATGTGAGTC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1091582719 12:1798869-1798891 ATGTGAGTCCAGAAGGAGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1091582715_1091582723 22 Left 1091582715 12:1798855-1798877 CCACCCGATCGCGGATGTGAGTC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1091582723 12:1798900-1798922 CCCGAACTGCCCTGAGCCCAGGG 0: 1
1: 0
2: 3
3: 23
4: 178
1091582715_1091582725 23 Left 1091582715 12:1798855-1798877 CCACCCGATCGCGGATGTGAGTC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1091582725 12:1798901-1798923 CCGAACTGCCCTGAGCCCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091582715 Original CRISPR GACTCACATCCGCGATCGGG TGG (reversed) Intronic
1080983143 11:37431447-37431469 TCCTCACATCCCCGATGGGGTGG + Intergenic
1081072959 11:38632694-38632716 GACTCACAGCTGCGATGTGGTGG - Intergenic
1085109737 11:73876969-73876991 GACTCACTTCCGGGAAGGGGCGG + Exonic
1085716671 11:78879310-78879332 TCCTCACATCCCAGATCGGGTGG - Intronic
1089616424 11:119697193-119697215 GACTCACAGCCGAGAGAGGGGGG + Intronic
1091582715 12:1798855-1798877 GACTCACATCCGCGATCGGGTGG - Intronic
1097052706 12:56232857-56232879 GACTCACATCCTCATTCAGGTGG - Exonic
1121259447 14:92555540-92555562 GCCTCACATCCTGGGTCGGGTGG + Intronic
1157382478 18:47231882-47231904 GACTCACATCTGTAATTGGGAGG + Intronic
1162458219 19:10798533-10798555 CACTTACATCCGGGAACGGGAGG + Exonic
1168016532 19:53578129-53578151 GACTCACATCCCCGGCCGGCTGG - Exonic
1168348599 19:55662739-55662761 GGCTCACTTCAGCGACCGGGTGG - Intronic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
945845205 2:214936192-214936214 GATTCACATGCCAGATCGGGTGG - Intronic
1175957348 20:62618188-62618210 GAGTCACATCCGAGAACAGGAGG - Intergenic
1026688997 7:72536242-72536264 GACTCACATCTGGGTTGGGGAGG + Intergenic
1027400232 7:77798981-77799003 GCATCACCTCCGCGCTCGGGTGG + Intronic
1055110822 9:72557596-72557618 GACTCACAACCTAGATCTGGGGG - Intronic