ID: 1091582820

View in Genome Browser
Species Human (GRCh38)
Location 12:1799307-1799329
Sequence CCCGGAGTCCCGCTGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091582810_1091582820 4 Left 1091582810 12:1799280-1799302 CCTGAGAGCTTCCTGGGGCCCCT 0: 1
1: 0
2: 3
3: 87
4: 453
Right 1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 170
1091582813_1091582820 -7 Left 1091582813 12:1799291-1799313 CCTGGGGCCCCTGGAACCCGGAG 0: 1
1: 0
2: 1
3: 26
4: 297
Right 1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 170
1091582805_1091582820 20 Left 1091582805 12:1799264-1799286 CCCGCAGGGGAATCATCCTGAGA 0: 1
1: 0
2: 0
3: 13
4: 208
Right 1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 170
1091582806_1091582820 19 Left 1091582806 12:1799265-1799287 CCGCAGGGGAATCATCCTGAGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091582820 Original CRISPR CCCGGAGTCCCGCTGAGGGC TGG Intronic
900361076 1:2289455-2289477 CCCCGAGCCCCGCGCAGGGCAGG + Intronic
900405630 1:2491784-2491806 CCCGCAGTCCTGCTGTGGGTGGG + Intronic
900405670 1:2491949-2491971 CCCGCAGTCCTGCTGCGGGTGGG + Intronic
901628311 1:10635865-10635887 CCTGGAGTCCAGCTCAGGGAGGG + Intergenic
901666959 1:10831555-10831577 CCCGGAGTCCAGCTGGAGACTGG + Intergenic
902545912 1:17190326-17190348 CCCTGAGTCCCCATCAGGGCTGG - Intergenic
902982961 1:20138824-20138846 CCAGGATTCCTGCTGAAGGCAGG - Intergenic
908401323 1:63774700-63774722 CCCGGAGCCCCGCGGCGGGCCGG + Intronic
909376480 1:74947939-74947961 CCCTGAGTCCCTGGGAGGGCAGG - Intergenic
912717058 1:111990120-111990142 CCCGGAGTCTCGCCGCGGGAGGG + Intergenic
915520562 1:156439978-156440000 CCCTCCCTCCCGCTGAGGGCTGG + Intergenic
918078756 1:181190131-181190153 CCAGCAGCCCCGCTGCGGGCTGG - Intergenic
919731517 1:200916284-200916306 CCTGGGGTCCCACTGAGGCCAGG + Intergenic
920364686 1:205441881-205441903 CCCTGGCTCCTGCTGAGGGCCGG - Intronic
922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG + Intronic
923591810 1:235327258-235327280 CCCGGCGTCCGGCGCAGGGCCGG + Intronic
924426313 1:243953228-243953250 CCCGGGGTACTGCTGAGGACTGG - Intergenic
1063010023 10:2012442-2012464 CCTGGAGTCCTGCTGGGGGACGG + Intergenic
1063936298 10:11082094-11082116 CCCAGAGTCCTGTGGAGGGCAGG + Intronic
1064086398 10:12349323-12349345 CCTGGAGCCCCGGCGAGGGCGGG - Intergenic
1073057142 10:100710090-100710112 CCCGGAGCGCCGCGGAGGGAGGG - Intergenic
1076854528 10:133109323-133109345 CCTGGAGGCCCGCTGGGGTCAGG - Intronic
1077265683 11:1648398-1648420 CGCGGAGTCCCCGTGAGGGATGG + Intergenic
1077372607 11:2190427-2190449 CCCGGCTTCCTGCAGAGGGCGGG - Intergenic
1077610705 11:3641883-3641905 CCAGGGGTCCGGGTGAGGGCGGG + Exonic
1077867474 11:6234869-6234891 GCCGGAGTCCTTCTGAGGGGCGG - Intronic
1078660098 11:13278717-13278739 CCCGGAGCCCGGGTGCGGGCCGG + Intronic
1079188502 11:18258218-18258240 CCCTGCGCCCCGCTGAGGGGTGG - Intergenic
1079618868 11:22528826-22528848 CACGGAGTCTCGCTGATTGCTGG - Intergenic
1083185965 11:61018082-61018104 CCCTGAGTCAGGCTGAGGTCAGG + Intronic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083412829 11:62505765-62505787 CCAGGGGTCCTGCTGGGGGCGGG - Intronic
1083430593 11:62612177-62612199 CCCGGAGTAACGCAGGGGGCAGG + Intronic
1083780350 11:64914327-64914349 GCCGGGGTCCAGGTGAGGGCAGG - Exonic
1084961351 11:72718365-72718387 CCCGAGGTCCAGCTGAGGCCCGG + Intronic
1085308749 11:75503579-75503601 CCCTGAGGCCTGCTGTGGGCTGG - Intronic
1085516888 11:77116715-77116737 CCTGGAGGCAGGCTGAGGGCAGG - Intronic
1087199875 11:95334697-95334719 CCAGGAGTCATGGTGAGGGCAGG + Intergenic
1089316109 11:117592440-117592462 CCTGGAAGCCCCCTGAGGGCTGG + Intronic
1089376779 11:118000164-118000186 CCCAGAGGCCCGATGAGGGGAGG - Exonic
1090029745 11:123196190-123196212 CCAGGAGGCTCGCGGAGGGCAGG + Intergenic
1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG + Intronic
1092906087 12:13101522-13101544 CCCGGCGAGCCGCGGAGGGCGGG + Intronic
1094443513 12:30505415-30505437 CCTGGAGTCCTGCTGAGGAAGGG - Intergenic
1096105379 12:48994660-48994682 CCCAGAGTCCCTCTGGGTGCGGG + Intergenic
1096619064 12:52851094-52851116 CCCAGAGTCCAGAAGAGGGCTGG + Intergenic
1097192149 12:57224745-57224767 CACGCAGTCCCGCAGCGGGCAGG - Intronic
1101962529 12:109260562-109260584 CCCGGAGCTCCGCATAGGGCGGG - Exonic
1103364042 12:120369408-120369430 CCCCGAATCCCGGTGCGGGCCGG + Intergenic
1104723445 12:131060101-131060123 CTTGGAGTCCTGGTGAGGGCTGG + Intronic
1112319534 13:98394455-98394477 CCTGGAGACCCCCTGTGGGCTGG + Intronic
1113790255 13:113024691-113024713 TCCGGAATCTCGCTGAAGGCCGG - Exonic
1115147330 14:30240348-30240370 CCCCGCCTCCCCCTGAGGGCAGG - Intergenic
1115331321 14:32201633-32201655 CCCGAAGTCTCTCTGAGAGCTGG - Intergenic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1120569682 14:86101658-86101680 CACGGAGTCTCGCTGATTGCTGG - Intergenic
1121492164 14:94368587-94368609 CCCTGAGTCTCCCTGGGGGCTGG - Intergenic
1121544200 14:94751543-94751565 CCCTGAGTGCCTCTGGGGGCTGG + Intergenic
1122599360 14:102913642-102913664 CCCGGTGTGCACCTGAGGGCTGG - Intergenic
1124153872 15:27208438-27208460 CCCTGAATACCACTGAGGGCAGG - Intronic
1126600714 15:50424503-50424525 CCCGGCGTCACGGTGAGTGCGGG + Exonic
1129788329 15:78323691-78323713 CCCGGGCCCACGCTGAGGGCTGG + Intergenic
1129903923 15:79172759-79172781 CCAGGAGCCCAGCAGAGGGCTGG - Intergenic
1130564086 15:84980410-84980432 CCCGGAGGCGTGCTGCGGGCTGG - Intergenic
1132839574 16:1972470-1972492 CCAGAAGTCCCGATGAGGGGAGG + Intronic
1133229167 16:4358356-4358378 CCCCGAGTCCGGGTGAGGGTGGG - Exonic
1133381564 16:5335412-5335434 CCCCCAGTCCCGCTGATGACGGG - Intergenic
1133765098 16:8832454-8832476 CCCGTGGTCCTGCTGGGGGCTGG - Intronic
1135669698 16:24364783-24364805 CCCTGAGTTCAGCTGAAGGCCGG + Intergenic
1138534785 16:57654085-57654107 CCTGGAGGCCGGCTGTGGGCTGG - Exonic
1141690096 16:85591675-85591697 GACGGAGTCCCGGTGAGGTCCGG - Intergenic
1142012301 16:87721862-87721884 GGCGGAGTCCTGCTGAGGACGGG - Intronic
1144778477 17:17796427-17796449 GGCGGAGGCCCTCTGAGGGCCGG + Exonic
1145074721 17:19842788-19842810 CCCGGAATCCACATGAGGGCTGG - Intronic
1148216379 17:45835963-45835985 CCAGGAGAGCCCCTGAGGGCCGG + Intergenic
1148356606 17:46979380-46979402 CCCGGAGTCCCGGTGCTGGAGGG + Intronic
1148770092 17:50061496-50061518 CCCGGCCTCCCACTGAGGCCCGG + Intronic
1149806043 17:59619353-59619375 CCCTGAGTCACGGAGAGGGCGGG + Intergenic
1150282913 17:63939918-63939940 CCCTGACTCCCGCTCAGGTCTGG + Exonic
1151570628 17:74923750-74923772 CCCGGAGTCCAACGGAGCGCGGG + Intergenic
1151946005 17:77320273-77320295 CCCGGCGTCCCGCTCAGAGGCGG - Intronic
1152016958 17:77757065-77757087 CCTGGAGTCCCACTCAGGGTGGG + Intergenic
1152174955 17:78781734-78781756 CCCCGAGCCCCGCAGAGGGGCGG + Intronic
1153384578 18:4477694-4477716 CACGGAGTCTCGCTGATTGCTGG + Intergenic
1158406667 18:57165887-57165909 ACTGGAGTCACCCTGAGGGCAGG - Intergenic
1160090751 18:75824823-75824845 CCCTGAGTGCCCCTGAGGCCAGG + Intergenic
1160298334 18:77657609-77657631 CCCTGAGTGGCGCTGAGGCCCGG - Intergenic
1160537658 18:79603683-79603705 GCCGCAGTCCCTCTCAGGGCGGG - Intergenic
1160622213 18:80179432-80179454 GCCAGTGGCCCGCTGAGGGCAGG - Intronic
1160864530 19:1250997-1251019 CCCGGAGGCCCGCGGGGGGAGGG - Intronic
1161061981 19:2219834-2219856 CCCGGGGTCCAGCTGTGGGGAGG - Intronic
1161172622 19:2820468-2820490 CCCGGTGTCCCCTGGAGGGCAGG - Intronic
1162312142 19:9913907-9913929 CCCGGAGCCCGGCGGGGGGCGGG + Intronic
1162780097 19:13002402-13002424 CGAGGAGCCCCTCTGAGGGCGGG + Intronic
1163846569 19:19641651-19641673 CCTGGGGTCTCCCTGAGGGCTGG + Intronic
1164148922 19:22532281-22532303 CCCAGAATCCCTCTGATGGCAGG - Intronic
1165213828 19:34254998-34255020 CCCGGAAGCCCGCGGAGGGAGGG + Intronic
1165697012 19:37908155-37908177 CCCAGAGACCCTCTGAGGGTGGG + Intronic
1165808461 19:38596281-38596303 GGCGGAGTCTTGCTGAGGGCGGG - Intronic
1166105720 19:40597203-40597225 CGCCGAGTCCCGCTCCGGGCGGG - Intronic
1167452652 19:49581285-49581307 ACCTGAGTCCCGCCCAGGGCAGG + Intronic
925398984 2:3558373-3558395 GGCGGAGTCCTGATGAGGGCCGG + Exonic
947745040 2:232503107-232503129 CCAGGAGTCCCGCAGCGGCCAGG - Intergenic
948454074 2:238096716-238096738 CCCGGGGTCCTGCTGGGCGCAGG - Intronic
948806605 2:240455903-240455925 CCCTGAGGCCCGCTGCAGGCTGG - Intronic
948889885 2:240902384-240902406 ACAGGAGGCCAGCTGAGGGCAGG - Intergenic
1168813985 20:724129-724151 CTGGCAGTCCAGCTGAGGGCTGG - Intergenic
1169143934 20:3240430-3240452 CCTGGAGTCGCGCTGGGGGAGGG - Intergenic
1170150291 20:13221061-13221083 CTCGGAGTCCCGGGGAGGGCCGG - Intergenic
1172447093 20:34998965-34998987 GCCTGAGCCCCGCTGAGGGTGGG + Intronic
1172668068 20:36614380-36614402 CCCTGTGTCCTGCAGAGGGCTGG - Exonic
1176256784 20:64157121-64157143 CCCGGCTTCCTGTTGAGGGCAGG + Intronic
1176414690 21:6467724-6467746 GCCGGGGTCCCGGGGAGGGCGGG - Intergenic
1179690190 21:43076046-43076068 GCCGGGGTCCCGGGGAGGGCGGG - Intronic
1180342343 22:11628783-11628805 CCCGGAAGCCCGCAGAGGGGCGG - Intergenic
1183588526 22:38767062-38767084 TCCGGAGTCCCACTGACGTCAGG + Intronic
1184096152 22:42317629-42317651 CCTGCATTCCCGCTGGGGGCTGG + Intronic
1184173535 22:42773029-42773051 CCAGGAGGCCTTCTGAGGGCAGG - Intergenic
1184278141 22:43422046-43422068 CCCGGATGTCCCCTGAGGGCAGG - Intronic
950027757 3:9832513-9832535 CCTGGAGCCCAGCTGAGGGCAGG + Intronic
950450131 3:13060712-13060734 CCTGGAGCCCCGCCGGGGGCAGG - Intronic
950651954 3:14412864-14412886 CCCGAGGCCCTGCTGAGGGCAGG + Intronic
953928187 3:46992935-46992957 CCCAGTGACCCGCTGAGGGTGGG - Intronic
954430193 3:50466745-50466767 CCAGGAGTCCACCTGAGTGCAGG - Intronic
954614732 3:51963913-51963935 CCTAGAGCCCCACTGAGGGCAGG - Intronic
955899147 3:63733678-63733700 CACGGAGTCTCGCTGATTGCTGG + Intergenic
958772225 3:98438410-98438432 CCAGGATTCCTGCTGAGGGCAGG + Intergenic
964786149 3:160399006-160399028 CCCGGAGCCCCGCTGCCGCCAGG + Intronic
969295845 4:6270274-6270296 CCTGGAGCCCCGCCGCGGGCGGG + Intronic
969330339 4:6470983-6471005 GCCGGAGCCCCGCGGAGGCCCGG - Intronic
974589229 4:63921774-63921796 CCCGGAGTCACGGTGGGTGCAGG - Intergenic
996813336 5:127544642-127544664 CACGGAGTCCCGCTGATTGCTGG - Intronic
998152344 5:139764611-139764633 CCCGGCGCCCCGCAGTGGGCAGG + Intergenic
1002603550 5:180369032-180369054 CCTGGAGTCCCGCCGAGCACAGG + Intergenic
1003457865 6:6300379-6300401 CACGGAGTCTCGCTGATTGCTGG - Intronic
1004413088 6:15400033-15400055 GCAGGAGTCCAACTGAGGGCTGG - Intronic
1005058280 6:21751781-21751803 CCAGGAGTGCCCCTGGGGGCAGG + Intergenic
1007749790 6:44064848-44064870 CTCAGGGTCCCTCTGAGGGCAGG - Intergenic
1009984973 6:70771513-70771535 CCCGGAGTCTTGCTGATTGCTGG - Intronic
1015149431 6:130020542-130020564 CCCGGGTCCCCGCGGAGGGCTGG + Intronic
1015786583 6:136924547-136924569 CGAGGAGTCCCGCTGGTGGCTGG + Exonic
1017954971 6:159169769-159169791 CCCGTCGTCCCGCTCAGTGCTGG + Intronic
1018400464 6:163415073-163415095 CCCGGCGTCCCGCTCCGCGCCGG - Exonic
1019458492 7:1145070-1145092 CCCAGAGTGCCACTGAGAGCGGG - Intergenic
1019620134 7:1987842-1987864 CCCGTCGTCACGGTGAGGGCTGG - Intronic
1019740388 7:2670146-2670168 CCCTGAGGCCCCCTGAGGTCTGG + Intergenic
1028135400 7:87219355-87219377 CCCGGACTCCGCCAGAGGGCAGG + Intronic
1029711767 7:102303731-102303753 CCCGGGGTCACCCAGAGGGCAGG + Intronic
1030631029 7:111896003-111896025 CCCAAAGTCCCATTGAGGGCAGG + Intronic
1032095913 7:128938432-128938454 CCGGGAGCCCCGCTGGAGGCTGG + Intronic
1034252948 7:149706754-149706776 GGGGCAGTCCCGCTGAGGGCAGG - Intergenic
1034416044 7:150964739-150964761 CCCAAAGTCACGCTGAGGGCAGG + Intronic
1035156157 7:156915151-156915173 CACGGAGTCTCGCTGATTGCTGG - Intergenic
1035258235 7:157645759-157645781 CCCAGAGTCCCGGTGTGGGTGGG + Intronic
1036689801 8:10938038-10938060 CACGGAGTCTCGCTGATTGCTGG - Intronic
1037637218 8:20710872-20710894 TCCAGAGTCCCCCTGAAGGCTGG - Intergenic
1040543715 8:48380870-48380892 GCGGGAGCCGCGCTGAGGGCAGG + Intergenic
1040862010 8:52008649-52008671 CCAGGCGTCCAGCAGAGGGCAGG - Intergenic
1044868641 8:96597055-96597077 CCAGGTTTCCCTCTGAGGGCAGG - Intronic
1049583753 8:143423759-143423781 CACGGAGTCCAGCCGAGGGCTGG - Intronic
1050405399 9:5304013-5304035 CCCGGAGACCCGCAGGAGGCCGG - Intronic
1050408701 9:5339179-5339201 CCCGGAGACCCGCAGGAGGCCGG - Intronic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1052745834 9:32440383-32440405 CCCTGAGCCCTGGTGAGGGCGGG - Intronic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1060375959 9:123115330-123115352 CCAGGTCTCCCGCCGAGGGCAGG - Intronic
1060408423 9:123384039-123384061 CCCGGGGTCTCCGTGAGGGCAGG + Intronic
1061780239 9:132991563-132991585 CCCAGAGGCCAGCTGAGTGCTGG - Exonic
1062272322 9:135715085-135715107 CCCGCAGCCTGGCTGAGGGCTGG + Intronic
1062392716 9:136340371-136340393 CCCCGTGTCCCTCTGAGTGCAGG + Intronic
1062587357 9:137255341-137255363 CGCGGAGTCGCGCGGCGGGCGGG + Exonic
1186041165 X:5480822-5480844 CACGGAGTCTCGCTGATTGCTGG + Intergenic
1186176754 X:6932848-6932870 CACGGAGTCTCGCTGATTGCTGG + Intergenic
1189759866 X:44310352-44310374 ACCCGGGTCCCGCTCAGGGCCGG + Intronic
1192166226 X:68829249-68829271 CCCGGAGTCCCAGTGTGGCCCGG + Exonic
1195421240 X:104677734-104677756 CACGGAGTCTCGCTGACTGCTGG - Intronic
1200145851 X:153926316-153926338 CCGGGAGCCGCGCTGGGGGCGGG - Intronic
1201151121 Y:11096197-11096219 CCCAGAGTTCAGCTGAGGACTGG - Intergenic