ID: 1091583682

View in Genome Browser
Species Human (GRCh38)
Location 12:1803962-1803984
Sequence GGGAGGGTCAAGGGCATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091583670_1091583682 26 Left 1091583670 12:1803913-1803935 CCTGGCAGGCTGCATGAAAGAAG 0: 1
1: 0
2: 1
3: 29
4: 255
Right 1091583682 12:1803962-1803984 GGGAGGGTCAAGGGCATTCCAGG 0: 1
1: 0
2: 6
3: 25
4: 267
1091583669_1091583682 27 Left 1091583669 12:1803912-1803934 CCCTGGCAGGCTGCATGAAAGAA 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1091583682 12:1803962-1803984 GGGAGGGTCAAGGGCATTCCAGG 0: 1
1: 0
2: 6
3: 25
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091583682 Original CRISPR GGGAGGGTCAAGGGCATTCC AGG Intronic
900172173 1:1274382-1274404 GGGGAGGTCAGGGGCATCCCGGG - Intergenic
900782762 1:4628765-4628787 GGGAGGGGGAGGGGCCTTCCAGG + Intergenic
901146570 1:7069060-7069082 AGCAGGGTCAAGGGCATGGCAGG - Intronic
901154377 1:7125612-7125634 AGGAGGGACAAGGGCATTTCAGG + Intronic
901320251 1:8335656-8335678 GGGAGGCTCAGGGGCATCCTGGG - Intronic
901462008 1:9397622-9397644 GGGAGGAACAAGGGCCTTACGGG + Intergenic
901498319 1:9635599-9635621 GATAGGGTCAAGGGCATGCTGGG + Intergenic
903445407 1:23419398-23419420 GGGAAGGGGGAGGGCATTCCTGG - Intronic
903549173 1:24145806-24145828 GGGAGTGGAAATGGCATTCCAGG - Intergenic
903967606 1:27100198-27100220 GGGAGGGGCAGGGCCAATCCGGG + Exonic
906520562 1:46464604-46464626 GGGAGGGAGAAGGGCATTAGAGG - Intergenic
906689804 1:47785033-47785055 GAGAGGAGAAAGGGCATTCCTGG + Intronic
907317477 1:53581688-53581710 GGCTGGGGCAAGAGCATTCCAGG + Intronic
907324726 1:53629520-53629542 AGGAGGGCCAAGGGCATGGCTGG + Intronic
907424702 1:54372367-54372389 TGGAGGGGAAGGGGCATTCCAGG - Intronic
907923834 1:58937442-58937464 GGGAGGAGAAAGGGAATTCCAGG + Intergenic
908484965 1:64582491-64582513 GGGAGGGTCCAGGAATTTCCTGG - Intronic
910080377 1:83334568-83334590 GGGAGAGCCAAGGGAATTTCAGG + Intergenic
912253326 1:108033234-108033256 GGGAGAAACAAGGACATTCCAGG - Intergenic
912332794 1:108834839-108834861 GGGAGCCTCATGGGCCTTCCTGG + Intronic
912680535 1:111726299-111726321 GGGAGTGTCTAGGGCTTCCCTGG + Exonic
912861470 1:113217643-113217665 AGGAGGCTCAAGGCCAGTCCAGG + Intergenic
915359885 1:155279494-155279516 TGGAGGGGGAAGGGCATCCCTGG + Intronic
918510777 1:185311802-185311824 GGTTGGGTTAAGGGCCTTCCAGG - Intronic
920831411 1:209469170-209469192 GGGGGTGTCAATGGCATGCCTGG + Intergenic
920860085 1:209698851-209698873 GGGAGAGCCAAGGGCCTTCTAGG - Intronic
921363575 1:214353065-214353087 TGGAGGGTACAGGGCATTCTAGG - Exonic
922761402 1:228134158-228134180 GGGAGTGTCAGGGGCAGTCTTGG - Intergenic
924216100 1:241824085-241824107 AAGAGGGTCTAGGGCATTCCAGG + Intergenic
924528845 1:244876363-244876385 GAGAGAGGGAAGGGCATTCCAGG + Intergenic
1063096226 10:2911388-2911410 AGGAGGGCCCAGGGTATTCCTGG + Intergenic
1063818504 10:9806701-9806723 AGGAGGGTAAAGTGCATTTCAGG + Intergenic
1063982189 10:11463176-11463198 AGGAGGGTAAAGGGCATGCCGGG + Exonic
1066408237 10:35140787-35140809 AGAAGGGTAAAGGGCATTTCAGG + Intronic
1067807599 10:49404069-49404091 GGGAGGGCAGAGGGCAGTCCTGG - Intergenic
1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG + Intronic
1073470651 10:103720196-103720218 GGAAGGGGCAAGGGCCTTGCTGG + Intronic
1073964246 10:108970213-108970235 GAGAGGGTCACAGGCATTTCAGG - Intergenic
1074058176 10:109941619-109941641 GGGAGGTGCAAGAGGATTCCAGG - Exonic
1074587122 10:114778745-114778767 GGGAGGGACAAGAACACTCCTGG - Intergenic
1074942017 10:118245402-118245424 GGGAGGATCCAGCGCCTTCCTGG - Intergenic
1075264213 10:120987172-120987194 GGGAGGATGAAAGGCAGTCCAGG + Intergenic
1077080011 11:721010-721032 GGGAGGGTCAGGTGCGTTCCCGG + Intronic
1078505633 11:11940944-11940966 GTGAGGGTCAGAGGCATACCTGG + Intronic
1081194399 11:40143537-40143559 GTCTGGGTGAAGGGCATTCCAGG - Intronic
1081670374 11:44939035-44939057 GGGAGGATCATGGGCAGACCTGG - Intronic
1081714538 11:45239501-45239523 AGCAGGGACAAGGGCACTCCTGG - Intergenic
1081779862 11:45702771-45702793 AGCAGGGGAAAGGGCATTCCAGG + Intergenic
1081852761 11:46285223-46285245 GGGAGGTTCAAGGGCAAGCCAGG - Intronic
1082176451 11:49065884-49065906 GGGTGGGTCAAGGGAATTCAGGG - Intergenic
1082968577 11:58994454-58994476 TAAAGGGTCACGGGCATTCCAGG + Intronic
1082973744 11:59051717-59051739 TAAGGGGTCAAGGGCATTCCAGG + Intergenic
1083769708 11:64859828-64859850 GGAAGGGTCTCGGGCAATCCTGG + Intronic
1084380667 11:68810540-68810562 TGGAGGGTCCAGGGGCTTCCTGG + Intronic
1084968362 11:72756110-72756132 CTGAGCGTCAGGGGCATTCCTGG - Intronic
1085297532 11:75439496-75439518 GGGAGGGTCTAGGGCCAGCCTGG - Intronic
1086689262 11:89769990-89770012 GGGTGGGTCAAGGGAGTTCAGGG + Intergenic
1086716595 11:90069980-90070002 GGGTGGGTCAAGGGAGTTCAGGG - Intergenic
1088698679 11:112392352-112392374 AGGAGAGTCAAGAGCATCCCAGG - Intergenic
1090943345 11:131408187-131408209 GGGAGGGTGTTGGCCATTCCTGG - Intronic
1091583682 12:1803962-1803984 GGGAGGGTCAAGGGCATTCCAGG + Intronic
1091754691 12:3043759-3043781 GGAGGGGGCCAGGGCATTCCAGG + Intergenic
1092147106 12:6222331-6222353 GGGAGGGCCAGGGGCATGACTGG - Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1093740559 12:22680561-22680583 TGCAGGGTAAAAGGCATTCCAGG - Intronic
1095902351 12:47341067-47341089 GGGAGGGTCAAGCTCAGTCTGGG - Intergenic
1101751555 12:107586431-107586453 GTGAAGGACAAGGGCATTCAAGG - Intronic
1102549050 12:113677768-113677790 GGTGGGGTGAAGGGCATCCCAGG + Intergenic
1102747147 12:115259111-115259133 GGTAGGGACAAAGGAATTCCAGG + Intergenic
1102821830 12:115915086-115915108 AGGAGAGGCAAGGGCATTCCAGG + Intergenic
1102822866 12:115923326-115923348 GGGTGGGTGAAGGGGATTGCTGG - Intergenic
1103134746 12:118497925-118497947 GTCTGGGTCAAGGGCATTGCTGG - Intergenic
1103372384 12:120429541-120429563 GGGAGGGGGAAGAGCAGTCCTGG + Intergenic
1104899656 12:132181981-132182003 GGGAAGGTCAAGGTCAGCCCCGG - Intergenic
1107083395 13:36398896-36398918 AGGAAAATCAAGGGCATTCCAGG - Intergenic
1107340652 13:39401818-39401840 GACAGGGTTAAGGGCATTACTGG - Intronic
1110292161 13:73819853-73819875 TGTAGGGTGAGGGGCATTCCAGG + Intronic
1110704526 13:78589381-78589403 GGGAGGGTCAAGGGGAGAGCGGG - Intergenic
1112340811 13:98551613-98551635 TGGTGGGTAGAGGGCATTCCAGG - Intronic
1113400975 13:109992983-109993005 GCGAAGTTGAAGGGCATTCCTGG - Intergenic
1113489984 13:110683964-110683986 GGAAGGGGCAAGGGCAGCCCAGG - Intronic
1113641788 13:111962901-111962923 GGGAGAGTCCAGGGGGTTCCCGG - Intergenic
1113904461 13:113812840-113812862 GGGTGGGTCACAGGCATCCCGGG + Exonic
1114169256 14:20255108-20255130 GGGTGGGTCAATGTCATTACAGG - Intergenic
1114209459 14:20602823-20602845 TGGTGGGTCAGGGGCATGCCTGG - Intronic
1114260339 14:21031976-21031998 GGCAAGGGCAAGGGCATTGCGGG + Exonic
1116905073 14:50396569-50396591 GGGAGGGCTAAGGGCTTCCCCGG + Intronic
1116918225 14:50545791-50545813 GGGAAGTTCAAAGGCATGCCAGG + Intronic
1118349164 14:64961204-64961226 GGGAGGGGCTGGGGCACTCCTGG - Intronic
1119476398 14:74932523-74932545 GGGAGGGGGAAGGGATTTCCGGG + Intergenic
1119719842 14:76883319-76883341 AGGAGGGCCTAGGGCTTTCCGGG + Intergenic
1121017177 14:90555931-90555953 GGGAGGGTGATGGGGAATCCCGG + Intronic
1121573392 14:94964284-94964306 GGCAGGGGCAAGGGGCTTCCTGG - Intergenic
1122317459 14:100834648-100834670 GGGCTGGTCAAGGGCACCCCGGG - Intergenic
1122878458 14:104679368-104679390 GGGAGGGGGAAGGGAATGCCAGG + Intergenic
1123042356 14:105495630-105495652 GGTAGGGACAAGGGCAGACCAGG - Intronic
1124337454 15:28868012-28868034 GGGTGTGTGAAGGGCATCCCAGG - Intergenic
1124624693 15:31301163-31301185 GGGAGAGTCAATGCCATCCCTGG - Intergenic
1125796982 15:42410349-42410371 GGGAGGGTCTAGGAGACTCCGGG - Intronic
1126892195 15:53218442-53218464 GGGATGGTAAAGGGGATTCCAGG + Intergenic
1128813413 15:70587885-70587907 AGGAGGGGCAGGGGCATCCCTGG - Intergenic
1130660881 15:85830733-85830755 GGGAGGGCCAGGGGGAGTCCTGG + Intergenic
1130740221 15:86591399-86591421 GGAAGTGCCAAGGGCATTCCTGG - Intronic
1131510271 15:93045808-93045830 GGGAGTGTCTGGGGCATCCCTGG - Intronic
1132343342 15:101091749-101091771 GAGAAGGTCAAGGTCATTTCCGG - Intergenic
1132904280 16:2274159-2274181 GGGAGGGGCAGGTGCATTCAGGG - Intergenic
1133121232 16:3609629-3609651 GGGAGGGACAAGGGCATGTGGGG + Intronic
1133612894 16:7449976-7449998 GGGAGGGAGAAGGGCACTCCGGG + Intronic
1134611017 16:15607763-15607785 GGAAGGGTCAAGTGCAGTCCAGG + Intronic
1134675979 16:16090842-16090864 GGCAGGGTCTAGCGCCTTCCTGG + Intronic
1136461094 16:30410576-30410598 AGGAGGAGGAAGGGCATTCCAGG + Intronic
1136845011 16:33569386-33569408 GGGAGTGTCATTGTCATTCCTGG - Intergenic
1138452241 16:57100253-57100275 AGAAGGGGGAAGGGCATTCCAGG + Intronic
1138520069 16:57566005-57566027 GAGTAGGGCAAGGGCATTCCAGG - Intronic
1139503575 16:67387747-67387769 GGGAGGGGCAGTGGCATTGCTGG + Intergenic
1139504043 16:67390256-67390278 GGCAAGGGCAAGGGCATTGCGGG - Exonic
1142135372 16:88449545-88449567 GGGAGAGAGAAGGGCATTTCTGG - Intergenic
1142256645 16:89017264-89017286 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1142256663 16:89017314-89017336 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1142256726 16:89017493-89017515 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1142256759 16:89017583-89017605 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1203106719 16_KI270728v1_random:1418039-1418061 GGGAGTGTCATTGTCATTCCTGG - Intergenic
1203155179 16_KI270728v1_random:1869684-1869706 GGGAGTGTCATTGTCATTCCTGG - Intergenic
1142718633 17:1762183-1762205 GGGAGAGGCAGGGGCACTCCAGG + Intronic
1142941420 17:3382705-3382727 GGGAGTGGAAAGGGCATTTCAGG - Intergenic
1142959303 17:3542734-3542756 GGGAGGGCCAAGGGCAGCCGGGG - Intronic
1143346734 17:6255026-6255048 GTGAGGGGCAAGGGCATTTCTGG + Intergenic
1143505099 17:7359650-7359672 CTGAGGGTGAAGAGCATTCCAGG - Intergenic
1143555268 17:7655935-7655957 GGCAGGGTCAGGGACATTCCAGG - Exonic
1143931740 17:10436083-10436105 GGGAGGGTAAAAGGACTTCCAGG - Intergenic
1145007668 17:19346630-19346652 GGGAGGGCCCAGGGGATGCCTGG - Intronic
1146228426 17:31088023-31088045 GGGAAGGCCAAGGCCATACCTGG - Intergenic
1148463601 17:47851551-47851573 GAGAGGGTCAAGGGCCATCGAGG - Intronic
1148643562 17:49206060-49206082 GGGAGAGTCAAGGGCAGTGTAGG - Intronic
1148888485 17:50790616-50790638 GGGAGGGCCATGGGCATTCCTGG + Intergenic
1148893331 17:50823760-50823782 GAGAAGGTCAAGAGAATTCCAGG + Intergenic
1149669324 17:58391886-58391908 GAGAGGGTCAAGGTCAGTACTGG + Intronic
1150130851 17:62667981-62668003 GTGTGGGGGAAGGGCATTCCTGG + Intronic
1151179637 17:72317623-72317645 GGCAGGATCAAGCCCATTCCTGG + Intergenic
1151582969 17:74990603-74990625 GGGAGGGAAGAAGGCATTCCAGG + Intronic
1152583281 17:81178437-81178459 GGGAGGGCCAAGGTGATCCCTGG - Intergenic
1153188632 18:2513916-2513938 GGGAGAGTCACAGGCATTGCCGG + Intergenic
1153733074 18:8035041-8035063 GAGAGGGTCAAGGGAATGGCTGG - Intronic
1158011608 18:52735210-52735232 AGGGTGGTCAAGGGAATTCCTGG - Intronic
1159306673 18:66652343-66652365 GGGAGGGCCCAGGTCTTTCCAGG - Intergenic
1160706085 19:531074-531096 GGGAGGGGCGAGGGCTTCCCTGG - Intergenic
1160763610 19:797662-797684 GGGCGGGTCAGGGGCTTCCCGGG + Intronic
1160817498 19:1042887-1042909 GGGAGGGTCTGGGGCAGCCCGGG + Intronic
1161152962 19:2719334-2719356 GGGAGGGGCTAGGGCACACCAGG - Intronic
1161821738 19:6534140-6534162 GGGAGGGGTAAGGGGACTCCTGG - Intronic
1162341296 19:10092857-10092879 GGGAGGGGCCAGGGGATGCCTGG - Exonic
1162931429 19:13959689-13959711 GGGCGGGCCAAGGACAGTCCCGG + Intronic
1163349081 19:16764016-16764038 GGGAGGGTGAAGGGCAAACATGG + Intronic
1163497522 19:17655429-17655451 TGGAGGGTCAAGGGAAGTTCAGG - Intronic
1165118769 19:33545745-33545767 GGGAGGGTCATTGACATTTCTGG - Intergenic
1165408773 19:35645693-35645715 GGGAGGGTCCAGGGCTGTCTTGG - Intergenic
1167411673 19:49347686-49347708 GGGAGGGTCAGGGGCAGGTCTGG - Intronic
1168481582 19:56724615-56724637 GGGTTGCTCAGGGGCATTCCTGG + Intergenic
925741720 2:7010732-7010754 CAGAGGGTCAAAGGCATTGCAGG - Intronic
927517460 2:23680609-23680631 GGGAGGGTCATGGGCTCTCTAGG + Intronic
927721574 2:25386574-25386596 GGTAGAGTCATGGGGATTCCTGG + Intronic
927721609 2:25386873-25386895 GGGAAGGTCCAGAGCTTTCCTGG + Intronic
927968129 2:27284817-27284839 AGAAGGGCCAAGTGCATTCCTGG + Intronic
929054350 2:37863004-37863026 GGGAGGGCCAGGGGCCTGCCAGG - Intergenic
929599117 2:43194122-43194144 TGGAGGGTAAAGGGCGATCCAGG + Intergenic
934096954 2:88615494-88615516 GGAAGGGGCAAGGGCATCTCTGG - Intronic
934677656 2:96260996-96261018 TGGAAGATCAAGGGCCTTCCAGG - Intronic
934763791 2:96869557-96869579 GGGAGCGCCGAGGGCAGTCCAGG + Intronic
934861774 2:97769724-97769746 GGAAGGGCCCAGGGCATCCCTGG - Intronic
944434385 2:199671392-199671414 GGTTGGGAGAAGGGCATTCCAGG + Intergenic
946736135 2:222756488-222756510 GAGAGGGGAAAGGACATTCCAGG - Intergenic
948264708 2:236628132-236628154 GGGAGGGACCAGGCCATTTCAGG + Intergenic
948572102 2:238924228-238924250 GGAAGGCTCCAGGGCATCCCTGG - Intergenic
948894587 2:240922293-240922315 GGGAGGGGCAGGGGCATGCTGGG - Intronic
949000446 2:241610162-241610184 GGGAGTGTGAAGGCCATGCCCGG - Intronic
1168924147 20:1565937-1565959 GGGATGGTCAAGGGTATTACAGG - Intronic
1170464330 20:16609186-16609208 GCATGGGTCACGGGCATTCCAGG + Intergenic
1172308315 20:33897638-33897660 AGGATGGTGAAGGACATTCCAGG - Intergenic
1173750042 20:45469652-45469674 GGGAGGGTGGAGGGCTTTGCGGG - Intergenic
1173789976 20:45822276-45822298 AAGAAGGACAAGGGCATTCCAGG + Intergenic
1174107129 20:48170753-48170775 GGTAGGGTCAAGAGCATGTCTGG + Intergenic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1174231091 20:49046236-49046258 GGGTGGGGCCAGAGCATTCCTGG + Intronic
1175878159 20:62240196-62240218 GGGAAGGTAACTGGCATTCCGGG - Intronic
1178505363 21:33158288-33158310 GGTAAGGTCAAGGGCAGACCTGG + Intergenic
1179999776 21:44990239-44990261 AGGAGGGTCAGGAGCAGTCCTGG + Intergenic
1182114530 22:27747996-27748018 AGGAGGTTGAACGGCATTCCTGG - Intergenic
1182833484 22:33322655-33322677 GGGATGGACTAGGGCAGTCCTGG + Intronic
1183727398 22:39597362-39597384 GGGAGGGAGGAGGGCATTCATGG + Intronic
1184319938 22:43733566-43733588 CAGAGGGTAAAGGGCATTCACGG + Intronic
1185333918 22:50263159-50263181 GGGAGGGTCCAGGCCATTTGGGG - Intergenic
949959469 3:9300353-9300375 AGGTGGGTAAAGGACATTCCAGG - Intronic
950149515 3:10675830-10675852 GGGTGGGGAAAGGGCATTGCAGG - Intronic
950189581 3:10967236-10967258 GGAGGGGTGAAGGGCATTGCAGG + Intergenic
950214058 3:11145345-11145367 GAGAAGGCTAAGGGCATTCCAGG - Intronic
950520515 3:13495201-13495223 GGGACGATCAAGGGCTTCCCTGG - Intronic
953405244 3:42656668-42656690 GGCAGGGTCCAGGGCAGGCCTGG + Intronic
953911037 3:46893148-46893170 GGGAAGGGAAAGGACATTCCAGG + Intronic
955749975 3:62177708-62177730 AGGTGGGACAAGGGCCTTCCAGG - Intronic
956726349 3:72159635-72159657 GGGAGAGCCAAGGGCATTCCAGG + Intergenic
957797489 3:85030622-85030644 TGGAGGGTCAAGGGAATTCAAGG - Intronic
960080288 3:113533452-113533474 GGCCTGGTCAAGGGCATTGCTGG + Intronic
960979628 3:123210842-123210864 GGCAGGGAGGAGGGCATTCCAGG + Intronic
961381799 3:126500300-126500322 GACAGGGGCAGGGGCATTCCAGG - Intronic
961805717 3:129487949-129487971 GGGAGGGGCAAAGGCATTCCAGG + Intronic
964705546 3:159615124-159615146 GGTAGAGGTAAGGGCATTCCAGG + Intronic
967027320 3:185576179-185576201 AGGTGGGGGAAGGGCATTCCAGG + Intergenic
967113626 3:186317628-186317650 GGGAGGGAGAAGGGCATTCCGGG - Intronic
967557189 3:190874396-190874418 AGGATGTTCAAGAGCATTCCTGG - Intronic
967640818 3:191860935-191860957 GGGAGAGACAAGGCTATTCCAGG + Intergenic
967772436 3:193348952-193348974 GGGAGGGACAGGGGCAATCCAGG - Intronic
968648300 4:1750530-1750552 GGGTGGGTCCAGGGCAGTGCTGG + Intergenic
969516139 4:7649186-7649208 GGGATGAGGAAGGGCATTCCAGG + Intronic
970867891 4:20780063-20780085 GGGATGTTCAAGGGTATTTCAGG + Intronic
985377853 4:189360829-189360851 GGGATGGTCAAGGACAGCCCTGG + Intergenic
985783615 5:1883072-1883094 GGGAGGGGCCAGGACAGTCCCGG + Intronic
986701344 5:10412493-10412515 GGAAGTGGGAAGGGCATTCCAGG + Intronic
986714015 5:10509428-10509450 GGAAGGGTGCAGGGCATACCTGG - Intronic
987300915 5:16597610-16597632 GGGAGGACCAAGGGCAGTGCAGG - Intronic
988381645 5:30504337-30504359 GGGAGTCTCCAGGCCATTCCAGG + Intergenic
989707758 5:44358027-44358049 GAGGGGGGCAAGGGCATTTCTGG + Intronic
990343410 5:54847887-54847909 CGCAGGGTCAAGGGCAGTCAGGG + Intergenic
991403545 5:66278809-66278831 GGAAGGGGCAAGGGGCTTCCTGG + Intergenic
994066983 5:95554684-95554706 GGGGGGGTCTAAGGCATTCACGG + Intronic
999274548 5:150320694-150320716 GGGAGAGTCAAGGGCACTTTGGG - Intronic
999470693 5:151852266-151852288 GGAAGGAACAAGGGCATTCTGGG - Intronic
999630758 5:153568930-153568952 AGGATGGGAAAGGGCATTCCAGG - Intronic
1000045257 5:157517045-157517067 GTGGAGGTGAAGGGCATTCCGGG - Intronic
1004087027 6:12459775-12459797 GGGAGGGTCTACCACATTCCAGG - Intergenic
1004924354 6:20403379-20403401 AGGCGGGTCAAGGGCAGGCCCGG - Intronic
1005174369 6:23027210-23027232 GGGAGGATCCAGGGCTCTCCTGG - Intergenic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005835279 6:29704107-29704129 GGGACAGTGAAGGGCATCCCAGG - Intergenic
1006113020 6:31760157-31760179 GGGAGGGTCAAAGTCATCACTGG + Exonic
1006409406 6:33863605-33863627 GGAGAGGGCAAGGGCATTCCTGG - Intergenic
1007461379 6:42021674-42021696 AGGAGGATAAAGGGCATTCCAGG + Intronic
1007712984 6:43836370-43836392 GGGAGGAGGAAGGGCATTCCAGG + Intergenic
1008375827 6:50790315-50790337 AGGTGGGTGAAGAGCATTCCAGG - Intergenic
1011101578 6:83728214-83728236 GGGTGGGGCAGGGGCAGTCCTGG - Intergenic
1012492148 6:99793927-99793949 AGGAGAGTAAAGGGCTTTCCAGG + Intergenic
1013511669 6:110850362-110850384 GGGAGGGTCAAGGGAATTTGGGG - Intronic
1015117595 6:129666550-129666572 GAGAGGGCCAGGGGCATTCTTGG - Intronic
1015870598 6:137772671-137772693 GGAAAGATCAAGAGCATTCCGGG + Intergenic
1019305770 7:333687-333709 GGGCGGGACAAGGACATTCCTGG - Intergenic
1019971814 7:4547700-4547722 GGGAGGGGAAAGGGTATTCCGGG - Intergenic
1020107697 7:5429744-5429766 GGAATGGCCAAGGGCATTCGTGG + Intergenic
1021588629 7:22237039-22237061 GGCAGGGACAAGGGCATTCCAGG - Intronic
1022237067 7:28472668-28472690 GGGAGGGTTAAAGGCATCTCAGG - Intronic
1022473695 7:30697163-30697185 GGGAGGGTCCAGGGACTGCCAGG + Intronic
1023998267 7:45175173-45175195 GTGGGGGTCAGGGACATTCCAGG + Intronic
1027298153 7:76799834-76799856 GGGAGAGCCAAGGGAATTTCAGG + Intergenic
1028609975 7:92700104-92700126 AGGAGGGGCAAGGGCATGACTGG + Intronic
1031458873 7:122020474-122020496 GGAAAGGAAAAGGGCATTCCAGG + Intronic
1031623710 7:123968001-123968023 GGGAGGGTCAAGGGAAAGCAAGG + Intronic
1032364406 7:131285739-131285761 GGTGAAGTCAAGGGCATTCCAGG - Intronic
1034292705 7:149945539-149945561 GACAGGGTGAAGGGCAGTCCAGG + Intergenic
1034470150 7:151250513-151250535 GGGCAGGCAAAGGGCATTCCAGG - Intronic
1034813359 7:154151333-154151355 GACAGGGTGAAGGGCAGTCCAGG - Intronic
1034876506 7:154729271-154729293 GGGAGGGTCAGGGAGATTCTGGG + Intronic
1035560712 8:601748-601770 GGCAGGGGCGAGGGCACTCCAGG + Intergenic
1038391062 8:27201471-27201493 GGAAGGATTATGGGCATTCCAGG - Intergenic
1039721390 8:40168417-40168439 AAGAAGGGCAAGGGCATTCCAGG - Intergenic
1041182105 8:55259607-55259629 GTGAGGGTGAAGCACATTCCTGG + Intronic
1045092955 8:98766038-98766060 GGGAGAGTCAAGGGGATGACAGG - Intronic
1045680082 8:104649581-104649603 AGGAGGGGGAAAGGCATTCCAGG - Intronic
1047724389 8:127671397-127671419 GAGAGGGGAAAGGGCAGTCCAGG - Intergenic
1048170212 8:132099274-132099296 GGGAAGCCCAAGGGCATTGCAGG + Intronic
1048976020 8:139673589-139673611 GAGAGCTTCAAGGGCTTTCCAGG + Intronic
1049076542 8:140400838-140400860 GGGAGGGAGAAGGGCATTGGAGG - Intronic
1049235944 8:141512408-141512430 GGGAGGGGCAAAGGCAGTCGTGG - Intergenic
1049554303 8:143274526-143274548 AGGAAGGTAAAGGGCATTCGTGG + Intronic
1049675149 8:143885943-143885965 GGGAGGGGCAGGTTCATTCCAGG - Intergenic
1049779863 8:144423990-144424012 GGGAGGGTCTCGGGCACTGCGGG + Exonic
1049968938 9:804341-804363 GAGAGGGAGAAGGGCATTCCAGG - Intergenic
1050438171 9:5630507-5630529 AGGACTGTCAAGGGCATTACAGG - Intronic
1051257142 9:15225890-15225912 GGAAGGGTTGTGGGCATTCCTGG - Intronic
1055748851 9:79481735-79481757 GGGAGGTTCTTGTGCATTCCTGG + Intergenic
1058445928 9:105054759-105054781 GGAAAGGTCAAAGGCATGCCAGG + Intergenic
1058527392 9:105873675-105873697 GGGTAGGTCAAGGGCATTCCAGG + Intergenic
1060155869 9:121319279-121319301 CGGAGAGTGATGGGCATTCCAGG + Intronic
1060736537 9:126069851-126069873 GGGAGGGGCAGGGCCATGCCGGG - Intergenic
1060989310 9:127839078-127839100 AGCAGGGTAGAGGGCATTCCAGG - Intronic
1061042716 9:128149275-128149297 GGGAGAGTGAGGGACATTCCCGG - Intronic
1061053215 9:128208018-128208040 GGAAGGGACAAGGGCATTGGGGG - Intronic
1061053900 9:128211668-128211690 GGCAGGGTGAAGAGCTTTCCAGG - Intronic
1061250040 9:129421215-129421237 TGGAGGGGAAAGGGCATTCCTGG - Intergenic
1061378976 9:130242948-130242970 AGGAGAGGCAAGGGCATTCCAGG + Intergenic
1062107625 9:134764335-134764357 GGGGGGTTCAAGGGCATTGTGGG + Intronic
1062118598 9:134822161-134822183 GGGAGGGGCTTGGTCATTCCTGG + Intronic
1062211335 9:135365933-135365955 GGGAGCGTTTGGGGCATTCCTGG - Intergenic
1203749312 Un_GL000218v1:63717-63739 GGCTGGGTCCAGGTCATTCCTGG - Intergenic
1186046127 X:5538253-5538275 GGGAGGGCCAATGGTCTTCCAGG - Intergenic
1186474387 X:9845888-9845910 GGGAGGCTCAAGGGCACCCCTGG - Intronic
1186533931 X:10327956-10327978 GGGTGGGCCTAGGGCATTTCTGG + Intergenic
1186950177 X:14615661-14615683 GAGGAGGTAAAGGGCATTCCAGG + Intronic
1187572837 X:20522070-20522092 AGGAGTGTCAAAGGCATGCCAGG + Intergenic
1189310003 X:40012354-40012376 GGGAGGGCTAAGGGCGCTCCAGG + Intergenic
1190810922 X:53882521-53882543 AAGAGGGGCAAGAGCATTCCAGG - Intergenic
1194731682 X:97463032-97463054 GAGAGGCTCAAGGGAATTCAGGG + Intronic