ID: 1091584243

View in Genome Browser
Species Human (GRCh38)
Location 12:1806841-1806863
Sequence CTGGAGGCCTAGAGATAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091584237_1091584243 10 Left 1091584237 12:1806808-1806830 CCCAGATGCTGGGGCTTCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 223
1091584238_1091584243 9 Left 1091584238 12:1806809-1806831 CCAGATGCTGGGGCTTCTGTCCT 0: 1
1: 2
2: 0
3: 36
4: 260
Right 1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091584243 Original CRISPR CTGGAGGCCTAGAGATAAGC AGG Intronic
900117578 1:1035068-1035090 CTGGAGGGGCAGAGAAAAGCAGG + Intronic
900418294 1:2545009-2545031 CTGCAGACCCAGAGATAATCCGG + Intergenic
901103591 1:6738038-6738060 CTGGAGGCCAAGAGAAAGGGTGG - Intergenic
902511421 1:16968992-16969014 ATGGAGGCCCAGAGAGAAGTGGG + Intronic
902546851 1:17195580-17195602 CTGGAGGGGAAGAGATGAGCAGG + Intergenic
902922711 1:19676612-19676634 CTGGAGGCCTAGAAAGAGCCGGG + Intronic
903209882 1:21812006-21812028 CTGAGGGCCTAGAGAGCAGCAGG - Intergenic
903275594 1:22219360-22219382 CTGGAGGCAGAGAGATCTGCTGG - Intergenic
904542170 1:31240303-31240325 CTGGAGCCCTAGAGACAGGGTGG - Intergenic
904551221 1:31320472-31320494 CTGGGGGCATAGAGAGAATCTGG - Intronic
905120701 1:35679636-35679658 CAGGAGGCCTAGAGATGTGGGGG - Intergenic
905295012 1:36948776-36948798 CTGGAGGGCTGGAGACAAGGAGG - Intronic
905352422 1:37356801-37356823 CTGAAGCCCTGGAGATAAGCTGG + Intergenic
906696712 1:47828175-47828197 CAGGAGCCCTAGAGAGAAGGAGG - Intronic
906933813 1:50194639-50194661 CTGGAGACCAAGAAAGAAGCAGG + Intronic
907188685 1:52631766-52631788 CTGGAGGCCTGGAGATCAGCTGG - Intergenic
907849964 1:58247110-58247132 CTGGAGGCCAGGAGATGAGCTGG + Intronic
908883353 1:68758780-68758802 CTGGCTGCCTAGATATAAACTGG + Intergenic
908988013 1:70048884-70048906 CTGCAGCCCTAGACACAAGCAGG + Intronic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
910352978 1:86320898-86320920 GTGGAGGCCTAGGGGTAAGCTGG + Intergenic
920272893 1:204780071-204780093 CTGGAGGCAATGAGATAAGGTGG + Intergenic
924948276 1:248860446-248860468 CTGGAGGCCAAGGCATCAGCAGG + Intergenic
1065060044 10:21890579-21890601 GTGGAGGCCTAGAGGCAAGCAGG + Intronic
1067058401 10:43065360-43065382 CTGCAGGCCTAGAGCTCACCAGG + Intergenic
1067542540 10:47166279-47166301 CTGGAGGCCTAGACAAGAGGAGG + Intergenic
1068773834 10:60850723-60850745 CAGGAGGCCTAGAACTAAGCTGG + Intergenic
1070052855 10:72905813-72905835 CTGGGGTCCTAGACTTAAGCAGG + Intronic
1071344566 10:84680282-84680304 CTGGAGGCCAAGGGAGAAACTGG + Intergenic
1073643758 10:105278562-105278584 CTGCAAGCCTAGGGATAGGCAGG + Intergenic
1076472252 10:130727433-130727455 CTGTAGGCTCAGAGATCAGCAGG - Intergenic
1077024407 11:432846-432868 CTGGAGGACTGGGGAGAAGCAGG + Intronic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1078480210 11:11668848-11668870 CTGGACGCGTGGAGAAAAGCAGG + Intergenic
1078717943 11:13857608-13857630 CTGGGGGCTTACAGACAAGCAGG + Intergenic
1078895565 11:15594246-15594268 TTGAAGGCCCAGAGAGAAGCTGG + Intergenic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1090843017 11:130508995-130509017 GTGGAGGCCTAGTGAGGAGCTGG - Intergenic
1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG + Intronic
1092749991 12:11709817-11709839 CTGGAGACCCAGAGAAGAGCCGG - Intronic
1093535678 12:20219882-20219904 CTGGTGGCATAGACACAAGCTGG + Intergenic
1097216513 12:57418035-57418057 CTGGAGTGCTAGAGAGAGGCAGG - Intronic
1097509217 12:60515238-60515260 CTGGAAGCCTAGAGTGGAGCTGG + Intergenic
1097588575 12:61545278-61545300 CAGGAGGCCGAGAGAGAAGGGGG + Intergenic
1101777341 12:107806523-107806545 CTGGAGGCCTGGAGCAGAGCAGG + Intergenic
1102541445 12:113622332-113622354 CTGGAGGCCTGCAGGGAAGCTGG + Intergenic
1111647155 13:91045947-91045969 CTGGAGGCCTAGATAATAGAGGG + Intergenic
1116272419 14:42788626-42788648 CTGAAGGCCTAGGGTTGAGCAGG - Intergenic
1119116247 14:72024451-72024473 CTGGAGGACAGGGGATAAGCAGG - Intronic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120290421 14:82563149-82563171 CTGGAGTCCTAGATATTGGCAGG - Intergenic
1120747484 14:88165402-88165424 CTGGAGCCCTACAGAGCAGCAGG + Intergenic
1120853219 14:89189373-89189395 CTGAAGGCCTAGCCATAAGAAGG + Intronic
1120979556 14:90278325-90278347 CTGGAGGATTAGAGAGCAGCGGG - Exonic
1122632746 14:103114473-103114495 CAGGAAGACTAGAGATAAGAAGG - Intergenic
1122797356 14:104212680-104212702 CTGGAGGCCCAGAGAGGACCCGG + Intergenic
1128805861 15:70530833-70530855 CTGGACACCTAGTGATAAACAGG + Intergenic
1129018139 15:72487739-72487761 CTGGAAGCCCAGAGACAAGGAGG - Intronic
1132617812 16:851058-851080 ATGGAGACCTAGAGATAAACGGG - Intergenic
1135984256 16:27172531-27172553 GAGGAGGCCTAGAGACTAGCTGG + Intergenic
1136269499 16:29140187-29140209 CTGGGCGCTGAGAGATAAGCCGG - Intergenic
1138443140 16:57047045-57047067 CTGGAGGCCTAGAGAGAGGTGGG - Intronic
1139602910 16:67997707-67997729 CTGGAGGCCAGGAGATCAGGAGG + Intronic
1141240687 16:82262469-82262491 TGGGAGGGCTAGTGATAAGCAGG + Intergenic
1142354161 16:89594261-89594283 CTGGAGGCCGAGAGCCAGGCTGG + Intronic
1147250123 17:39148175-39148197 TTGGAGCCCTAGAGACAATCTGG + Intronic
1147356926 17:39905651-39905673 CTGCAGGCCAAGAGGGAAGCAGG - Intronic
1149785589 17:59432062-59432084 CTGGAGGCCAAGAAATCAACAGG + Intergenic
1151967826 17:77440861-77440883 CTGCAGGCATGGAGATCAGCAGG - Intronic
1153232110 18:2948300-2948322 CTGCTGGCTTAGAGATAGGCTGG + Intronic
1154372823 18:13780173-13780195 ATGGATGCATAGAGATAGGCAGG + Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155517514 18:26638427-26638449 CTGAAGGCCAAGAGATCTGCTGG + Intronic
1156466353 18:37350008-37350030 CAGGAGGAGGAGAGATAAGCAGG + Intronic
1157813650 18:50716029-50716051 ATGGAGGACAAGACATAAGCTGG - Intronic
1159748303 18:72268048-72268070 CTGGAGGACGAGAGAAAAGTAGG - Intergenic
1160568865 18:79803243-79803265 CTGGGGGCCTGGAGATGAGGGGG - Intergenic
1160568881 18:79803300-79803322 CTGGAGGCCTAGAGGTGAGGGGG - Intergenic
1164754310 19:30678635-30678657 CTGGACTCCTAGAGCCAAGCAGG + Intronic
1164783057 19:30909096-30909118 CTGGAGGCCTAGAGAACAAGAGG + Intergenic
1166822215 19:45587586-45587608 CTGGAGGGCTAGAGAAGAGAGGG - Intronic
1168227384 19:55005552-55005574 GTGGAGGCCAAAAGATAAGATGG + Intergenic
926957720 2:18319764-18319786 TTTGAGGCCTAAAGTTAAGCAGG + Intronic
927224695 2:20752273-20752295 CTGAAAGCATAGAGATAAACAGG + Intronic
928174241 2:29023297-29023319 CTGAAGGCTGAGAAATAAGCAGG - Intronic
928203077 2:29263641-29263663 CTAGAGGACTAGAGAAAAGAAGG + Intronic
930247837 2:49003320-49003342 GTGGGGACCTAGAGATAAACTGG + Intronic
932747067 2:74342651-74342673 CAGGAGTCCTGGAGATCAGCTGG - Intronic
934753802 2:96811186-96811208 CTGGAAGCCTGGAGAGAAGGTGG + Exonic
939094704 2:137821389-137821411 CTGGAGGCCTAGTAATCAGGGGG - Intergenic
941281734 2:163560463-163560485 AGAGAGGCCAAGAGATAAGCTGG - Intergenic
941624223 2:167812770-167812792 CTGGAGCCCTAAAAATAATCTGG - Intergenic
942379746 2:175376570-175376592 GTGCTGGCCTAGAAATAAGCTGG + Intergenic
943436017 2:187866854-187866876 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436024 2:187866910-187866932 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436200 2:187868141-187868163 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436207 2:187868191-187868213 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436234 2:187868385-187868407 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436252 2:187868532-187868554 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436326 2:187869066-187869088 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436382 2:187869480-187869502 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
946843510 2:223839468-223839490 CAGGAGGCCTAGAGGTGGGCAGG + Intergenic
948906712 2:240983135-240983157 AGGGAGGCCTAGAGAGATGCTGG + Intronic
949028116 2:241775709-241775731 CTGGAGGTCTACAGAGCAGCTGG + Intergenic
1169494892 20:6105741-6105763 CTGTAGGCCAAGAACTAAGCTGG - Intronic
1170867982 20:20177372-20177394 CAGGAGGTCTGGAGATAGGCAGG + Intronic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1173854019 20:46238146-46238168 CTGAAGGACTAGAGGAAAGCAGG - Intronic
1173884647 20:46446647-46446669 GTAGAGGCCTAGGGAGAAGCTGG - Intergenic
1174060956 20:47832801-47832823 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174061190 20:47834143-47834165 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174061306 20:47834869-47834891 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1174070221 20:47894454-47894476 CTGGAGGCCTGGGGAGGAGCTGG + Intergenic
1174070586 20:47896556-47896578 CTGGAGACCTAGGGAGGAGCTGG + Intergenic
1174070801 20:47897734-47897756 CTGGAGACCTAGGGAGGAGCCGG + Intergenic
1174070941 20:47898569-47898591 CTGGAGACCTAGGGAGGAGCTGG + Intergenic
1174100161 20:48121213-48121235 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174100702 20:48124251-48124273 CTGGAGCCCTAGGCATTAGCTGG - Intergenic
1174149227 20:48474430-48474452 CTGGAGACCTAGAGAGGAGCTGG - Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1174153119 20:48500089-48500111 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174156173 20:48516772-48516794 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1175694157 20:61088771-61088793 CTGGAGCCCAAAAGAGAAGCAGG - Intergenic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1176726589 21:10440657-10440679 GTGGAGGCCAAGTGAAAAGCAGG - Intergenic
1178356384 21:31913337-31913359 CAGGAGGCAGAGAGATTAGCAGG + Intronic
1179943709 21:44656045-44656067 CTTAAGGCCTAGGGACAAGCCGG + Intronic
1179946941 21:44684992-44685014 CTTAAGGCCTAGGGACAAGCCGG - Intronic
1180090953 21:45533631-45533653 CTGGAGGCCCAGAGTCCAGCAGG - Intronic
1180287795 22:10766428-10766450 GTGGAGGCCAAGTGAAAAGCAGG + Intergenic
1180787933 22:18557342-18557364 CAGGAGGCCTGGAGCTATGCTGG + Intergenic
1181233805 22:21437976-21437998 CAGGAGGCCTGGAGCTATGCTGG - Intronic
1181244845 22:21496867-21496889 CAGGAGGCCTGGAGCTATGCTGG + Intergenic
1181458828 22:23074321-23074343 CTGGAGGCCCTGAGAAATGCAGG + Intronic
1181538094 22:23557234-23557256 CTGGAGGTATAGAAATAAGCAGG - Intergenic
1182107391 22:27699096-27699118 CTGAATGCCTAGAGATGAGAAGG + Intergenic
1182919948 22:34070071-34070093 CTGGAGCCCGGGAGAGAAGCTGG - Intergenic
1183132317 22:35850481-35850503 CTGGAGGCCTCCAGATATGCAGG + Intronic
1184103823 22:42355758-42355780 CTGGAGGCCTAGAGACCTGGAGG + Intergenic
1184716980 22:46288038-46288060 CTGGAGACCCAGAGAAAAGTGGG + Intronic
949158883 3:857827-857849 CTGGAGACCTGCAGAGAAGCCGG - Intergenic
949159278 3:860529-860551 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159306 3:860776-860798 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159375 3:861318-861340 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
951373860 3:21888968-21888990 CTGCAGGTCTAGAGATACTCAGG + Intronic
952850656 3:37725819-37725841 CTGGAGGCTTAGAGAAAGGATGG + Intronic
955579171 3:60400449-60400471 CTGGAGGTATAGAGATAAGAGGG - Intronic
956894968 3:73650128-73650150 CTGGAGGCACAGAGATCACCAGG + Intergenic
959329779 3:104988952-104988974 CTGTATGCCTAGAAATAATCAGG - Intergenic
959431888 3:106264374-106264396 CTCACTGCCTAGAGATAAGCAGG - Intergenic
960057733 3:113287165-113287187 CAGGAGGCCCACAGATAAGCTGG + Exonic
961333073 3:126154329-126154351 CTGGAGGCCTCCAGCTACGCAGG + Intronic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
961727652 3:128943352-128943374 CGGGAGGGCAAGAGAGAAGCGGG - Intronic
962070774 3:132032113-132032135 CTGGAGACTTGGAGATAAACAGG + Intronic
964452943 3:156829620-156829642 GTGGAGCCCTAGTGAAAAGCAGG + Intronic
964966202 3:162496348-162496370 CTGGAGGCCTAGAAAGAAAATGG - Intergenic
965407856 3:168293133-168293155 GTGGAAGCCTGGAGATTAGCTGG + Intergenic
966568758 3:181415524-181415546 CTAGAGGGGTAGAGATAAACTGG - Intergenic
968500726 4:948602-948624 CTGCAGGCCTGGAGGTGAGCGGG + Intronic
968990734 4:3909832-3909854 CTGGAATCCTAGTGATGAGCTGG + Intergenic
970885802 4:20986248-20986270 CTTGAGTCCTAGAAATAAGTTGG + Intronic
971185633 4:24373120-24373142 CTGCAGGCCATGAGATAAGTAGG + Intergenic
971493166 4:27235983-27236005 GTGAAGGAATAGAGATAAGCAGG + Intergenic
971799783 4:31273489-31273511 TAGGAGGCCTTGAGTTAAGCAGG + Intergenic
972129760 4:35817653-35817675 CTGTGGGCCTAGAGACAATCTGG + Intergenic
972284891 4:37638621-37638643 CTGGGGGCCTAGAGAAAGGAGGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
981918342 4:150059226-150059248 CTGGAGGCTTAGAGATTCACTGG + Intergenic
983817434 4:172149548-172149570 ACAGAGGCCCAGAGATAAGCAGG - Intronic
988065433 5:26225306-26225328 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
988065540 5:26226146-26226168 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065571 5:26226392-26226414 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065606 5:26226634-26226656 CTGGAGACCCAGAGAAGAGCTGG - Intergenic
988065635 5:26226881-26226903 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065721 5:26227617-26227639 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988297969 5:29390710-29390732 CCGGAGGCCTACAGATGAGAGGG - Intergenic
990563575 5:57007129-57007151 CTGGAGGCCAAGAAATGAGTTGG - Intergenic
991601507 5:68355570-68355592 CTGGGGGTCTTGGGATAAGCGGG - Intergenic
992495137 5:77285029-77285051 CTGGACGTCTAGGCATAAGCTGG - Intronic
993189272 5:84660532-84660554 CTGGAGCCCTAGAGAAAGCCAGG - Intergenic
1002523727 5:179804839-179804861 TTGGAGGCCTCAAGAGAAGCTGG - Intronic
1003164944 6:3669524-3669546 CCAGAGGCCCAGAGATAAGCTGG + Intergenic
1004105474 6:12663881-12663903 TTGGAGGCCCAGAGACATGCAGG - Intergenic
1006096482 6:31659644-31659666 CTTGAGTGCTAGAGATAGGCTGG + Exonic
1007496626 6:42264444-42264466 CAGGAGGCAGAGAGAGAAGCTGG + Intronic
1007697663 6:43744013-43744035 TTGGAGGCCCAGGAATAAGCAGG - Intergenic
1007753141 6:44081988-44082010 AGGGAGGCCTGGGGATAAGCAGG + Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1013327963 6:109067207-109067229 CTGGAGACCTACAGATAGGGAGG - Intronic
1017009306 6:150052589-150052611 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1017009540 6:150053985-150054007 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1017009767 6:150055360-150055382 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1017646626 6:156545190-156545212 CTGGAGGCAAAGAGCTAACCTGG + Intergenic
1018614882 6:165677295-165677317 CTGGAGGCCCAGGGAAGAGCTGG - Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1021908344 7:25358974-25358996 CTTAAGGCCTAGAGAGAAGCAGG + Intergenic
1023507716 7:40917989-40918011 CTGAAGGCCTAGATATAGGAGGG + Intergenic
1024842188 7:53600120-53600142 CTGGAAGCCCAGAGGAAAGCGGG + Intergenic
1025031788 7:55562777-55562799 GTGGAGGCCTAGTGAGAAGAGGG + Intronic
1025233117 7:57216199-57216221 CTGGAGGCCTGGGGAGGAGCTGG + Intergenic
1025233840 7:57220383-57220405 CTGGAGACCTAGGGAGGAGCCGG + Intergenic
1030194530 7:106840635-106840657 CTGTAGGCCTGGAGATGAGGTGG - Intergenic
1030206883 7:106959839-106959861 TTGGAGGCAGAGAGAGAAGCAGG + Intergenic
1032547258 7:132754299-132754321 CTGGAGGCCAGGACATCAGCAGG + Intergenic
1032891883 7:136205492-136205514 CTGGATACCTAGGGAAAAGCTGG + Intergenic
1033231801 7:139604072-139604094 CTGGCGGACTGGAGGTAAGCAGG - Exonic
1034603519 7:152287294-152287316 GTGGAGGCCAAGTGAAAAGCAGG + Intronic
1038550054 8:28459692-28459714 CTGGATGCCTAGTAATAAGAGGG - Intronic
1039042852 8:33424555-33424577 CGAAAGGCCTAGAGAGAAGCAGG + Intronic
1039081030 8:33734135-33734157 CGGGAGGCCTAGAGCAAAGAAGG + Intergenic
1041690327 8:60680225-60680247 CTGGAGGCCAAGCGGTCAGCGGG + Intronic
1042482712 8:69322370-69322392 CTGGAGACCTAGAGAAAAGCTGG + Intergenic
1043561610 8:81500097-81500119 CTGGAGGCCTAGGGTCAAGCAGG + Intergenic
1046226376 8:111285748-111285770 CTGGAGGCCTAGGGGTAAAAAGG - Intergenic
1047311989 8:123699694-123699716 TTGGAGGCCCATAGACAAGCTGG + Intronic
1047343939 8:124009376-124009398 CTGGAGGCCTGGGGAGGAGCTGG + Intronic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1048770981 8:137894831-137894853 CTGTTGGCTTACAGATAAGCTGG + Intergenic
1051291528 9:15550572-15550594 GTTGAGGCCAAAAGATAAGCGGG + Intergenic
1052635162 9:31093748-31093770 GAGGAGGCCTAGAGAAAAGTAGG + Intergenic
1052736142 9:32344580-32344602 CTGGAAGCCTTCAGATGAGCTGG + Intergenic
1056688819 9:88788484-88788506 CTGGAGGACTTGAGATCAACTGG - Intergenic
1057696027 9:97323609-97323631 CTGGAGGGCCAGGCATAAGCTGG - Intronic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1060161578 9:121369873-121369895 CTGGCGGCCGCGAGATAACCAGG + Intronic
1061165867 9:128921930-128921952 ATTGAGGCCTAGAGAGAGGCAGG + Exonic
1062074339 9:134576311-134576333 CTGGTGGCCAAGATAGAAGCAGG - Intergenic
1062486259 9:136777835-136777857 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1186177763 X:6943155-6943177 CTGGAGGCCTTAACATAAGCAGG + Intergenic
1187232147 X:17433574-17433596 CTGGATGCCTAGAGGAAAGGTGG + Intronic
1187502709 X:19853242-19853264 CTGCAGGGCCAGAGACAAGCAGG + Intronic
1189090739 X:38080079-38080101 CTGGAGGCCTAGAAATGCCCTGG - Intronic
1189245166 X:39557705-39557727 CTGGTGGCCTAGAGGGAAACAGG + Intergenic
1189960559 X:46320820-46320842 CTGGAGGTATAGAGATGAGAAGG + Intergenic
1193148911 X:78104739-78104761 CTTGAAGCCTAGAGATTTGCAGG - Intronic
1194114006 X:89873573-89873595 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG + Intronic
1199239599 X:145530680-145530702 TTGGAGGCCTAGAAATCTGCAGG - Intergenic
1199719542 X:150532632-150532654 GCAGAGGCCTAGAGAGAAGCTGG + Intergenic
1200136630 X:153878401-153878423 CTGGAGGCCAAGAGATGACTTGG + Intronic
1200466746 Y:3528929-3528951 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic