ID: 1091584591

View in Genome Browser
Species Human (GRCh38)
Location 12:1808905-1808927
Sequence CATGAAAGGGAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1097
Summary {0: 1, 1: 0, 2: 9, 3: 120, 4: 967}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091584580_1091584591 19 Left 1091584580 12:1808863-1808885 CCGGTGCTCTGTCTGGGGAGGAG 0: 1
1: 0
2: 9
3: 41
4: 333
Right 1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG 0: 1
1: 0
2: 9
3: 120
4: 967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091584591 Original CRISPR CATGAAAGGGAGAAGGGGGA GGG Intronic
900274337 1:1814083-1814105 AATAAAAGTGGGAAGGGGGAGGG - Intronic
900307406 1:2017856-2017878 CATGGAAGGGACACGTGGGAAGG + Intergenic
900893200 1:5464581-5464603 CATGAAAGGAAGAAGGGGTCTGG + Intergenic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901329684 1:8396176-8396198 CAGGAAAGTGGGAGGGGGGAAGG + Intronic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
902178105 1:14666685-14666707 CGTGAAAGGGAGAAAGGGACTGG - Intronic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902622321 1:17657685-17657707 AATTAAAGGGGGAAGAGGGAGGG + Intronic
902672929 1:17987547-17987569 CAAGAAGGGGTGCAGGGGGAAGG - Intergenic
903293389 1:22328807-22328829 GATGGACGGGGGAAGGGGGAGGG + Intergenic
903654775 1:24942571-24942593 CCAGGAAGGGAGAAGGGGGCTGG + Intronic
903974252 1:27138768-27138790 CATGAAGTGGAGAAAGGGGTGGG + Intronic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904130564 1:28272559-28272581 CCTGGAAGGGACAAGGGGGGAGG - Exonic
904213226 1:28899430-28899452 CAGGAAAGGGGGAAGAGGGGAGG - Intronic
904408052 1:30306608-30306630 AGTGGAAGGGAGAAGGGGAAGGG - Intergenic
904422705 1:30404474-30404496 CATGACAGGGGGAGTGGGGAAGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905287936 1:36896563-36896585 CATGAAAGGCAGAAAAGGGCTGG + Intronic
905661350 1:39728445-39728467 AATGATACGGAAAAGGGGGAGGG - Intronic
905925084 1:41743869-41743891 AATGGAAGGGAAATGGGGGAGGG + Intronic
905933812 1:41807878-41807900 CATGATGGGGGGCAGGGGGAAGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906005664 1:42467535-42467557 TATGAAATAGAGAAGGAGGAGGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906636775 1:47415643-47415665 CATGACAGGGGTATGGGGGAGGG + Intergenic
906843550 1:49165628-49165650 CAAGAAAGGGAAAAGAAGGAGGG + Intronic
906882571 1:49608164-49608186 AAAGAAAGGAAGAAAGGGGAAGG + Intronic
907267746 1:53272970-53272992 CCTGAAAGGGGGAAGGGGAAAGG + Intronic
907326318 1:53640799-53640821 CATGAAAGGGGCATGGGGTAGGG - Intronic
907462522 1:54613430-54613452 CATGAAGGGAAGAAAAGGGAGGG - Intronic
907905526 1:58781719-58781741 TATTAAAGGGGGGAGGGGGAGGG - Exonic
908326680 1:63029999-63030021 CCTCAATGGGAGAAGAGGGATGG - Intergenic
908699794 1:66886778-66886800 CAGGGAAGGGAGTAGGGGCAGGG - Intronic
909798471 1:79774664-79774686 CAGGAAAGAGAGGAGGGGGGAGG + Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910480119 1:87649601-87649623 AAAAGAAGGGAGAAGGGGGAGGG - Intergenic
910534491 1:88281202-88281224 CATGAAAGAGAATAAGGGGAAGG - Intergenic
910734732 1:90441009-90441031 AAGAAAAGGGAGAAGAGGGAAGG - Intergenic
910830262 1:91454098-91454120 CATGAGAGGGAAATGGGTGAAGG - Intergenic
911348033 1:96721044-96721066 CATGAAAGGGAAAGTGGAGATGG - Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
911620884 1:100065593-100065615 AAGGAAAGGGAAAAGGGGAAGGG - Intronic
911877288 1:103184097-103184119 CATGAAAGATAGAAGGTTGAAGG - Intergenic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912245417 1:107957060-107957082 CATGAAACTGAGAAGAGAGAGGG + Intronic
912532868 1:110339098-110339120 AATGAAAGGGATAAGGAGGTGGG + Exonic
912705494 1:111908829-111908851 TGTGAAAGGGAGAAGGAGGGGGG + Intronic
913255241 1:116947264-116947286 CATGACAGGGAGGAGGGGCTGGG - Intronic
913323634 1:117607267-117607289 CAAAAAAGGGCGAAGGGGAAGGG - Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914908785 1:151768243-151768265 CCTGGATGGGAGAATGGGGAGGG + Intronic
914927802 1:151904104-151904126 CATTAAGGAGAGAATGGGGAGGG + Intronic
915029668 1:152867298-152867320 ATTGAAAGGGAGAAGAGTGATGG + Intergenic
915088982 1:153408509-153408531 CATGAAAGTGAGGAGGAGAATGG + Intergenic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915357767 1:155266447-155266469 CAAGAAAGGGAGAAAGGAAAAGG + Intronic
915731993 1:158060389-158060411 CATGAAAGATAGAAGTGTGAGGG - Intronic
916786034 1:168087784-168087806 GATGAACGGGAGAAGAGGGGTGG - Intronic
916805947 1:168261336-168261358 GATGAAAGGGGGAGGGAGGAAGG - Intergenic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917493449 1:175518395-175518417 CATGAGAGGAGGAATGGGGATGG - Intronic
917512545 1:175680292-175680314 CAGAAAAGGGAGAGGGGGCAGGG + Intronic
918261153 1:182797532-182797554 CATGAAAGGCAGAAGAGGTATGG - Intronic
918322009 1:183373370-183373392 CATGGAAAGGAGAAGGGAGAAGG - Intronic
919234345 1:194819354-194819376 GAAGAATGGGAGAAGGGAGAGGG + Intergenic
919793285 1:201305979-201306001 CATGGAAGGGAGATGGCTGAGGG + Intronic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920330232 1:205202077-205202099 GGGGAAAGGGAGAAGGGGAAGGG + Intronic
920441125 1:205980898-205980920 AAAGAAAGGAAGAAAGGGGAAGG - Intronic
920460412 1:206135327-206135349 CAGGAAAGGGAGATGAGGTAGGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920701936 1:208224511-208224533 ATTTAAAGGGAAAAGGGGGAGGG + Intronic
921114938 1:212081151-212081173 TAGGAAAGGGAGAAGGGCAAGGG + Intronic
921132171 1:212229332-212229354 GAAGAAAGGGAAAAGGAGGAAGG - Intergenic
921320551 1:213934347-213934369 CTGGAAACGGAAAAGGGGGATGG + Intergenic
922085880 1:222346461-222346483 AATGAAAGAGAGAAGGGAGATGG + Intergenic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
922657466 1:227398698-227398720 AATGAAAGAGAAAAGGGAGATGG - Intergenic
922887076 1:229028352-229028374 AATGGAAGGGAGGAAGGGGAGGG + Intergenic
923127576 1:231045974-231045996 AAAGAAAGAGAGAAGAGGGAGGG + Intergenic
923482382 1:234397324-234397346 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923854206 1:237828523-237828545 CATGAATGTGGGAAGGAGGAGGG + Intronic
924020028 1:239771213-239771235 GATGAAATGAAGAAGGGAGAGGG - Intronic
924100210 1:240595419-240595441 CAGGAAAGGGTGCATGGGGAGGG - Intronic
1063766571 10:9148352-9148374 GATGAAGGGGAGGAGGGAGAGGG - Intergenic
1064409959 10:15096763-15096785 GATAAAAGGGAGAAGGAGTATGG - Exonic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066559254 10:36651357-36651379 GATGAAGAGGAGAAGGGGAAAGG - Intergenic
1067127483 10:43532066-43532088 CATGAAAGTGACAAGGAGAATGG - Intergenic
1067167988 10:43880345-43880367 CATGGAAGGGAGAAGGGACCAGG + Intergenic
1067282904 10:44886402-44886424 CCTGCAGGAGAGAAGGGGGAGGG - Intergenic
1067360769 10:45575965-45575987 CAGCAAAGGGAGAAAGGGGTGGG - Intronic
1067409833 10:46054655-46054677 CAGCAAAGGGAGATGGGGAAGGG + Intergenic
1067465326 10:46494026-46494048 CATGAAACAGAGAAGGGAGGGGG + Intergenic
1067621861 10:47890575-47890597 CATGAAACAGAGAAGGGAGGGGG - Intergenic
1068017271 10:51532857-51532879 AAAGAAAGGGAGAAGGGGAGAGG - Intronic
1068695058 10:59958930-59958952 GAAGAAAGAGAGAAGGGGGAAGG - Exonic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1069745477 10:70712251-70712273 CAGGAAAGGGGAAAGGGGTAGGG + Intronic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070330450 10:75412888-75412910 CATGCAAGGAAGGAGGGGAAAGG - Intergenic
1070362377 10:75703254-75703276 CAGGAAGGGAAGAAGGGAGAAGG + Intronic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070520025 10:77244507-77244529 TGTGGAAGGGAGAAGGAGGAAGG + Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070962715 10:80510053-80510075 CATGAGAGAGATAAGAGGGATGG - Intronic
1071455275 10:85844310-85844332 CATAAAAGAGAAAATGGGGAAGG + Intronic
1072473349 10:95734558-95734580 AATTAAACGGAGAAGGGGGAAGG + Intronic
1072767123 10:98104246-98104268 CAGGAAGGGGAGAAGAGGGGAGG - Intergenic
1072848475 10:98859623-98859645 CTGGAAAGGGAGAAGAGGGTTGG - Intronic
1073136684 10:101224342-101224364 AATAAAAGGCAGAAGGGGAAGGG + Intergenic
1073142049 10:101254591-101254613 AATGAAAGGAAGAGGGGGAAAGG + Intergenic
1073476804 10:103759091-103759113 CATAGAAGGAAGCAGGGGGAAGG - Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073690912 10:105808627-105808649 CGGGAACGGGAGTAGGGGGATGG - Intergenic
1074326393 10:112455346-112455368 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1074415640 10:113264644-113264666 CATGAAGGGGAGTTGGGAGAAGG + Intergenic
1074524770 10:114253819-114253841 CATGAAAGGAAGATGGGAAAGGG - Intronic
1074561884 10:114542520-114542542 GAAGAAAGGAAGAAGGAGGAGGG + Intronic
1074843887 10:117379779-117379801 CATCAAGGAGAGAAGGGAGATGG + Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075122677 10:119675820-119675842 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1075284490 10:121171803-121171825 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284497 10:121171821-121171843 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284504 10:121171839-121171861 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075585434 10:123653789-123653811 AGGGGAAGGGAGAAGGGGGAAGG + Intergenic
1075674855 10:124289379-124289401 CATGGTTGGGAGAAGCGGGATGG - Intergenic
1075904131 10:126065848-126065870 CCTGGAAGGGAGTCGGGGGAAGG - Intronic
1076323613 10:129602736-129602758 CTGGAAAGGAAGGAGGGGGAGGG - Intronic
1076991168 11:276010-276032 CAGGAAAGAGAGTAGGGGAACGG - Intergenic
1077298273 11:1836027-1836049 CCGGAAAGGGTGACGGGGGAAGG + Intronic
1077352205 11:2098249-2098271 CATGCAAGGACGAGGGGGGAGGG - Intergenic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1077550063 11:3196280-3196302 CATGCAGGAGAGAAGGGGGCCGG + Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1077779267 11:5307655-5307677 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1077895709 11:6451635-6451657 CATGAAGGGATGAAGGGGAATGG + Intronic
1078380724 11:10837711-10837733 CAAGAAAGGGGGAGGGGGGAAGG - Intronic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1079225944 11:18604849-18604871 CATGAAAGTGTGAAGGGAGAAGG - Intergenic
1079252902 11:18800416-18800438 CTTGGAAGGGTGAAGGGGGTGGG + Intergenic
1079271248 11:18987912-18987934 CATGAAAAGGAGAAACGGGGCGG + Intergenic
1079494504 11:21026487-21026509 TATATAAGAGAGAAGGGGGATGG - Intronic
1079827476 11:25214876-25214898 TAAGAAAGGAAGAAAGGGGAGGG - Intergenic
1079918382 11:26399722-26399744 CAGGAAAGGGGGCAGGGGCAGGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080743706 11:35088712-35088734 CATGTAAGGGTAAAGAGGGAGGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081236799 11:40656265-40656287 CAAGAATGGGAGAATAGGGAAGG - Intronic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1081871393 11:46384212-46384234 CATGACAGTGGGAAGGGGGGAGG - Intergenic
1082244427 11:49905182-49905204 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1082794453 11:57369464-57369486 GATAAAAGGGAGAGGGGGCAGGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083024389 11:59537646-59537668 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083162030 11:60860327-60860349 CATGAAAAGAGGGAGGGGGAAGG - Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084197162 11:67530043-67530065 CATGCAATGGAGGTGGGGGATGG + Intergenic
1084357579 11:68650278-68650300 CAGGAAAGGGAGAATCCGGATGG - Intergenic
1084606703 11:70176693-70176715 CATGACAGGAAGCAGGGGGCGGG - Intronic
1084912737 11:72404271-72404293 CAAGAAAGGGAGGAGGGGTTTGG + Intronic
1085095344 11:73755817-73755839 GAAGGAAGGGAGAAGGGGGAAGG + Intronic
1085247098 11:75111118-75111140 TATGAAAGGGAGAAAGAAGAAGG + Intronic
1085259195 11:75194550-75194572 AATGAAAGGGGGAGGAGGGAGGG - Intronic
1085587906 11:77728602-77728624 AAGGGAAGGGAGAAGGGAGACGG + Intronic
1085879404 11:80448214-80448236 AAGGATAGGGAGAAGGGGAATGG - Intergenic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1086532638 11:87803796-87803818 CGTGAAAAGGAGAAGATGGAAGG + Intergenic
1086770011 11:90750420-90750442 GATGAAAGGTAAAAGGGAGATGG - Intergenic
1086921870 11:92596490-92596512 CATCAAAGGGAGAATGGTGGTGG - Intronic
1087122498 11:94589594-94589616 CAGGGAAGGGAGCAGGGGAATGG - Intronic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087582481 11:100075705-100075727 AATTCAAGGGAGAAGGGAGAAGG + Intronic
1088339300 11:108745059-108745081 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089183455 11:116598713-116598735 CATGAAAGGGAGAAGGGGCCTGG + Intergenic
1089213833 11:116823550-116823572 CATGGAAGGGAGGAGGGGAACGG + Intergenic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1090376709 11:126294702-126294724 CATGATAGGGAGAAGTGAGAGGG - Intronic
1090440190 11:126718902-126718924 CTTGAGTGGGAGAAGGGGGCTGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1090709481 11:129372951-129372973 CGGGGAAGGGAGAAGTGGGAGGG + Intergenic
1090910068 11:131110988-131111010 CAAGAAAGAGAGAAGAGAGAAGG - Intergenic
1091198213 11:133749910-133749932 GAGGAGAGGGAGAAGAGGGAGGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091849069 12:3680500-3680522 CATGCAAAGGAGGAGAGGGATGG - Intronic
1091866761 12:3845135-3845157 CACCAAAGGGAAAAGGGGGCTGG - Intronic
1092090253 12:5798215-5798237 CATGAAAGGCAGCCAGGGGACGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092799081 12:12145530-12145552 AGGGAAAGAGAGAAGGGGGAGGG - Intronic
1093673928 12:21911779-21911801 TATGCAAGGGAGAAGGATGATGG + Intronic
1093966764 12:25335934-25335956 CCTGAATGTGAGAAGGGGCAGGG - Intergenic
1094200276 12:27788015-27788037 TAGGAAGGGGAGAAGGGGAAAGG - Intronic
1094476034 12:30841370-30841392 CATGAAAGGGAAAAGGTTGAGGG - Intergenic
1095083443 12:38032944-38032966 CATGAAAGTGACAAGGAGAATGG + Intergenic
1095171741 12:39044269-39044291 CATGAAAGGAAGGTGGGGCAGGG - Intergenic
1095712916 12:45309146-45309168 CATGAAAGGGAGAAGGTGATTGG + Intronic
1095872249 12:47042143-47042165 AATCCAAGGAAGAAGGGGGAAGG - Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096744236 12:53715128-53715150 CAAGACAGAGAGAAGGGGTATGG + Intronic
1096758015 12:53816262-53816284 CATGAAAAGGAGAGGGAGGTAGG - Intergenic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1096988292 12:55776943-55776965 CCTGAAAGGGAGAAGAGTGCTGG - Intronic
1097107422 12:56634026-56634048 CTTAAAGGGGAGAAGGGGGCCGG - Intronic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097718904 12:62999334-62999356 GGTGAAAGAGAGAAGGAGGAGGG + Intergenic
1097776152 12:63648690-63648712 AAGGAAGGGGAAAAGGGGGAAGG - Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098889754 12:75997581-75997603 CATTAAAGGAAGCAGGGTGAGGG - Intergenic
1099764101 12:86960548-86960570 AAGGAGAGGGAGAAGTGGGAAGG - Intergenic
1100179396 12:92068686-92068708 CAAGAAAAGGAGAAGGGACAGGG + Intronic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100738182 12:97561515-97561537 CATGAAAGGAGGAAGGGGAGGGG + Intergenic
1100877297 12:98975417-98975439 CAAGAAAGAAGGAAGGGGGAGGG - Intronic
1101084873 12:101225858-101225880 AAGGAAAGGGAGAAGGGAGGAGG - Intergenic
1101316982 12:103638294-103638316 ATTGAAAGGGAGAATTGGGATGG - Intronic
1101571991 12:105962162-105962184 GAAGCAATGGAGAAGGGGGACGG + Intergenic
1101830562 12:108253340-108253362 AATGAAGGAGAGAAAGGGGAAGG - Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1101976738 12:109366074-109366096 CATGGACGGGAGAAGAGGGAGGG - Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102180904 12:110911553-110911575 CAAGAAAGGAAGAACAGGGAAGG - Intronic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1102510092 12:113409467-113409489 CATAAAAGGATGAGGGGGGAAGG - Intronic
1102518951 12:113467469-113467491 CAGGGAAGGGAGAAGAGGGGGGG - Intronic
1102625636 12:114233265-114233287 TTTGGAAGGGAGAAGGGGAAGGG - Intergenic
1102990445 12:117311890-117311912 CATGGAATGAAGAAGGGAGAGGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104091471 12:125521314-125521336 AAGGAAAAGGAGAAGGGGAAGGG - Intronic
1104172504 12:126295842-126295864 AAGGAAAGAGGGAAGGGGGAAGG + Intergenic
1104327542 12:127813396-127813418 CATGAAAGGGAGCAGAGGGCAGG + Intergenic
1104410153 12:128551068-128551090 CTGGAAAGGGAGAAGGGGAGAGG - Intronic
1104548956 12:129738408-129738430 GAAGAAAGGAAGAGGGGGGAAGG + Intronic
1104586594 12:130052866-130052888 CATGAATGGGGGAAGGGTGTTGG - Intergenic
1104928684 12:132327196-132327218 AAAGAAAGGAGGAAGGGGGAGGG + Intronic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106533600 13:30618054-30618076 CAGGTAAGGGAGAAGAGGGAGGG + Exonic
1107299226 13:38947908-38947930 CACGAAAGAGTGAGGGGGGATGG + Intergenic
1107690296 13:42946926-42946948 CATGAATGGGGCAAGGGGGATGG - Intronic
1107780685 13:43898930-43898952 CAGGAAAGAGAGAATGGGAAGGG + Intergenic
1108392059 13:49956273-49956295 GAGGAAGGGGAGGAGGGGGAGGG - Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1109045843 13:57409660-57409682 AATGAAAGGGACAAGTGGGAAGG + Intergenic
1109074191 13:57812325-57812347 GGTGAAAGGGAAAAGGAGGATGG + Intergenic
1109181545 13:59219986-59220008 GAGGAAGGGGGGAAGGGGGAAGG + Intergenic
1110117771 13:71841349-71841371 CAGGGAAGGGAGAGCGGGGAGGG + Intronic
1110261617 13:73491441-73491463 CATGAAAGTCAGAAGGGTGAGGG + Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1110590122 13:77246638-77246660 GAAGAAAGGGAGGAGGGAGAGGG + Intronic
1110619399 13:77578325-77578347 CAAGAAAGGGAGGAGGGGGAAGG + Intronic
1110868002 13:80419949-80419971 AAGGGAAGGGAGAAGGGAGAAGG - Intergenic
1111036294 13:82678364-82678386 CATGTAAGGGACAAGATGGAAGG - Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1112015175 13:95325571-95325593 AGGGAAAGGGGGAAGGGGGAAGG + Intergenic
1112036736 13:95503817-95503839 GCTGCTAGGGAGAAGGGGGAGGG + Intronic
1112605708 13:100904011-100904033 CATGAGATGGAGTAGGGGAAGGG - Intergenic
1113508814 13:110835183-110835205 CACCATAGGGAGAAGTGGGATGG - Intergenic
1113721802 13:112563059-112563081 CAGGAAAGTCCGAAGGGGGAGGG - Intronic
1113909687 13:113836269-113836291 GAGGAGGGGGAGAAGGGGGAGGG + Intronic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115643053 14:35347574-35347596 GATCAAAGGGAGGAGGGGGTGGG + Intergenic
1115834162 14:37378708-37378730 AAGGAAAGGAAGAAGGGAGAGGG + Intronic
1115934031 14:38531362-38531384 CATGAAAAGGAGTAGAGAGATGG + Intergenic
1116014081 14:39385866-39385888 CTTGAAAGGGAGCTAGGGGACGG - Intronic
1116299819 14:43164328-43164350 AATGAAAGTCAGATGGGGGAAGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117453632 14:55876237-55876259 CTTGCAAGGGAGAACGGGGAAGG + Intergenic
1117465035 14:55984651-55984673 CATGCAGGGGAGAAAGGAGAGGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117500770 14:56348955-56348977 TTTAAAAGGGAGAAAGGGGAAGG + Intergenic
1117706738 14:58477783-58477805 GAAGAAAAGGAAAAGGGGGAAGG - Intronic
1117964908 14:61197051-61197073 CATGAAAGTCAGAAGTGAGACGG - Intronic
1118062181 14:62151591-62151613 CATGAGAGGGAGAAAGGAGGGGG + Intergenic
1118134916 14:63012949-63012971 CATAAGAGGAACAAGGGGGATGG + Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118854360 14:69610080-69610102 CAGGGAGGGGACAAGGGGGAAGG - Intergenic
1119432036 14:74574848-74574870 CTCAAATGGGAGAAGGGGGAAGG + Intronic
1119568755 14:75651223-75651245 AATAAAAGGGAAAAAGGGGAAGG + Exonic
1119788069 14:77327360-77327382 CAGGGAAGGGAGATGGGGGTGGG + Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1121031090 14:90659306-90659328 GGAGAAAGGGAGAATGGGGAAGG + Intronic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121172253 14:91864319-91864341 CTTGTAGGGGAGTAGGGGGAAGG + Intronic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1121289098 14:92760081-92760103 CAGCAAAGGGAGATGGGGAAGGG - Intergenic
1121348023 14:93150518-93150540 AAAAAAAGGGAGAAGGGGCAGGG - Intergenic
1121452857 14:94020453-94020475 CATGGAAGGGGCAAGAGGGAGGG - Intergenic
1121455601 14:94037025-94037047 CATGAATGAGAGAAGAGGGATGG + Intronic
1121592393 14:95125746-95125768 CAGGGAGGGGAGGAGGGGGAGGG + Intronic
1121630574 14:95418926-95418948 GAAGAGAGGGAGAAGAGGGAAGG - Intronic
1121707539 14:96010272-96010294 CAAGAAAGAGAGAATGGAGAGGG + Intergenic
1122090857 14:99339260-99339282 CATGACAGGGACACTGGGGACGG - Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124879511 15:33628299-33628321 CAAGAAAGGAAGAGGGAGGAGGG + Intronic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1125532420 15:40422230-40422252 CATGAAAGGGAAGAGGGGTTGGG + Intronic
1125825315 15:42671550-42671572 CACATAAGGGAGAGGGGGGAAGG + Intronic
1125947681 15:43723305-43723327 AAAGAAAGAGAGAAGGGGCAGGG + Intergenic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1126952315 15:53894414-53894436 CAGGAAAGGGATAAAGGGGTTGG - Intergenic
1127570167 15:60234057-60234079 CATGAAAGGGAAAAGGTTCAAGG - Intergenic
1127770586 15:62226985-62227007 CATGCATGGGAGAAGGGAAAAGG - Intergenic
1128164987 15:65456132-65456154 CTTGAAAGAGAGTTGGGGGAAGG - Intronic
1128388760 15:67168689-67168711 GAAGAAAGGAAGAAGGGAGAGGG - Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128706097 15:69838398-69838420 CAGGGAAGGGAGCTGGGGGAGGG - Intergenic
1128885052 15:71279131-71279153 CAGGAAAGGGAGAAAATGGAGGG + Intronic
1128976806 15:72160307-72160329 GATGAAAGGGTGAAAGGGGCTGG + Exonic
1129003681 15:72354643-72354665 CATGAAAGGTACAAGAGGGCAGG + Intronic
1129044950 15:72725913-72725935 GGGGAAAGGGGGAAGGGGGATGG - Intronic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1129248953 15:74297726-74297748 CAGGAAAGAAAGAAGAGGGAAGG + Intronic
1129466460 15:75727037-75727059 CCTGAAAGGGAGTGGCGGGAAGG - Exonic
1129704193 15:77785240-77785262 CAAGAGAGGGAGATGTGGGAGGG - Intronic
1130052802 15:80497873-80497895 AATTTAAGGGAGAAGGGGGAAGG + Intronic
1130195518 15:81777096-81777118 CTTGAAAGGGAGAAAAGAGAAGG + Intergenic
1130426077 15:83801440-83801462 CATGAAATGGAAATGGAGGAGGG + Intronic
1130473784 15:84246618-84246640 CAGGAACGGGAGGAGGGGGATGG - Intergenic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130554912 15:84915816-84915838 CATTAAAGGGTGAGAGGGGAAGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131291714 15:91112147-91112169 GGGGATAGGGAGAAGGGGGATGG + Intronic
1131308110 15:91263820-91263842 ACTGAAAGGGAGGAGGGGCACGG - Intronic
1131701631 15:94942991-94943013 GAGGAAAGGGAGGAGGGGGTGGG + Intergenic
1132083288 15:98885387-98885409 AAGGAAAGGGAGAGGGGTGAGGG - Intronic
1133233613 16:4377762-4377784 CATCAAAGGGAGGAGGGAGGAGG - Intronic
1133677961 16:8093358-8093380 CATGTAAGGGTGGAGGGGGCAGG - Intergenic
1133937947 16:10284138-10284160 CAGGAAAGTGAGAAGGGGTGGGG - Intergenic
1134291709 16:12907034-12907056 GAGGGAAGGGGGAAGGGGGATGG - Intronic
1135353363 16:21749228-21749250 CATTAAACGGAGATGGGGGTCGG + Intronic
1135424444 16:22325386-22325408 CAGGAAAGGAAGGAGGGTGAAGG - Intronic
1135451850 16:22565351-22565373 CATTAAACGGAGATGGGGGCCGG + Intergenic
1135491139 16:22910787-22910809 CAGGAAAGGTAGAAGGGGAAGGG + Intronic
1135500341 16:22990671-22990693 CAAAGAAGGGAGAAGGGAGAAGG - Intergenic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1136726252 16:32359890-32359912 GATGAAAGAGGGGAGGGGGAAGG + Intergenic
1137246580 16:46710954-46710976 CATTAAAGGGAGGAAGCGGAAGG + Intronic
1137499226 16:48997694-48997716 GAGGAAAGGAAGCAGGGGGAGGG - Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1138093520 16:54194844-54194866 GAAGAATGGGAGAAGGAGGAGGG + Intergenic
1138303386 16:55951684-55951706 AATGAAAGAAAGTAGGGGGATGG + Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138927700 16:61612166-61612188 GAAGGAAGGGAAAAGGGGGAAGG + Intergenic
1138955213 16:61963244-61963266 CATGGAAGGGACATGGAGGAAGG - Intronic
1139147197 16:64339493-64339515 CAAGAATGGGGGAAGGGGGATGG - Intergenic
1139320412 16:66109707-66109729 AAAGGAAGGGGGAAGGGGGAAGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139558237 16:67726281-67726303 AAGGAAAGGGAGAGGGGGAAAGG + Exonic
1141151883 16:81570077-81570099 TATCAATGGGGGAAGGGGGATGG + Intronic
1141227985 16:82137339-82137361 CATGATCGGGAGAGGAGGGAGGG + Intergenic
1141238513 16:82242902-82242924 TATGAAGTAGAGAAGGGGGATGG + Intergenic
1141522027 16:84586979-84587001 GAGGAAAGGGAGCAGAGGGAGGG - Intronic
1141703033 16:85651086-85651108 GATGAAAGAAAGAAGGCGGAGGG - Intronic
1141882922 16:86871849-86871871 GAAGAAAGGGGGAAGGGGGAGGG - Intergenic
1141937818 16:87253556-87253578 GGTGAAAGGGAACAGGGGGAGGG + Intronic
1203000180 16_KI270728v1_random:157866-157888 GATGAAAGAGGGGAGGGGGAAGG - Intergenic
1203131781 16_KI270728v1_random:1694269-1694291 GATGAAAGAGGGGAGGGGGAAGG - Intergenic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143220243 17:5255493-5255515 GATGACAGAGAGAAGGGGAAGGG + Intergenic
1143963116 17:10736995-10737017 CATGAACTGGAGAGGGTGGAAGG + Intergenic
1144619576 17:16808766-16808788 CAATAAAGAGAAAAGGGGGAGGG - Intergenic
1144681764 17:17200673-17200695 CAAGGAAGGGGGAAGGGGGCAGG + Intronic
1144760140 17:17702494-17702516 CAAGAATGGGAGAAGGGGCATGG - Intronic
1144893109 17:18506938-18506960 CAATAAAGAGAAAAGGGGGAGGG + Intergenic
1145139108 17:20437354-20437376 CAATAAAGAGAAAAGGGGGAGGG - Intergenic
1145218988 17:21073179-21073201 CCAGGAAGAGAGAAGGGGGAAGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146319951 17:31839300-31839322 CATGAAAGGGACCCGGTGGAAGG + Intergenic
1146645520 17:34574566-34574588 AATAGAAGGGAGAAGGGGGAAGG + Exonic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1146940053 17:36838168-36838190 CAAGAAAGGAAGAAGGGAGGAGG - Intergenic
1146966312 17:37033971-37033993 CAAGCAAGGGAGAAGGGGTTAGG + Intronic
1147123499 17:38350603-38350625 GATGCAAGGGAAAAGGAGGAAGG - Intergenic
1147249463 17:39144378-39144400 CATGAAAGAGGGCAGGGCGAGGG + Intronic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147316888 17:39625315-39625337 CCTGAAAGGAAGAAGGGGTATGG - Intergenic
1147476163 17:40713470-40713492 AATGGGAGGGAGAAGGGGCAGGG - Intergenic
1148391975 17:47279305-47279327 GAAGAAAGCTAGAAGGGGGAGGG - Intronic
1148700608 17:49584524-49584546 CTTGAACGGGAGAGGGGGGATGG + Intergenic
1149109137 17:53005855-53005877 GTTGGAAGGGAGAAGGGAGATGG + Intergenic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149884990 17:60330886-60330908 AATGGAGGGGAGAAGGGTGAGGG - Intronic
1149896961 17:60435803-60435825 CATGAATGGGGGAAGCGGGGAGG + Intergenic
1150559756 17:66284361-66284383 CATGAAAAGTAAAAGGGGGCCGG + Intergenic
1151202854 17:72481479-72481501 TAGGAAAGGGTGAAGAGGGAGGG - Intergenic
1151594051 17:75066052-75066074 AATGAAAGGGAGGAGGGAGAAGG - Intergenic
1151643486 17:75413829-75413851 GAAGGAAGGAAGAAGGGGGAAGG - Intergenic
1151648982 17:75453968-75453990 CATGTAAGGCTGGAGGGGGAGGG + Intronic
1151801460 17:76382263-76382285 TTAGAAAGGGAGAAGGGGAAAGG + Intronic
1152022612 17:77788548-77788570 CATGTCAGGCAGAAGGGAGAGGG + Intergenic
1152197160 17:78924762-78924784 AAAGAAAGGGAGAGGAGGGAGGG + Intronic
1152256883 17:79245044-79245066 AAGGAAAGGGAGAGGAGGGAAGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152580168 17:81162286-81162308 CCTGAGAGGAAGTAGGGGGATGG + Intronic
1153333315 18:3896853-3896875 TCTTCAAGGGAGAAGGGGGAAGG - Intronic
1153342867 18:3993502-3993524 CATGAAGGGGAGAAAGGGAGGGG + Intronic
1153540585 18:6149840-6149862 AGAGAAAGAGAGAAGGGGGATGG - Intronic
1154333362 18:13447744-13447766 GAGGGATGGGAGAAGGGGGAGGG + Intronic
1155081856 18:22418356-22418378 CACCAAAGGGATAAGGGGGCAGG - Intergenic
1155135449 18:22987222-22987244 CAAGAGAGAGGGAAGGGGGAGGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156435396 18:37122375-37122397 CATGAAGGGGAGAAGAAGCAGGG + Intronic
1156592088 18:38501846-38501868 CATGCAAGGGATGAGAGGGAAGG + Intergenic
1156693946 18:39743848-39743870 CATGAAAGGGTGCAATGGGAAGG + Intergenic
1156736366 18:40264094-40264116 CAAGAAAGGGAGCAAGGGGAAGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156985057 18:43341307-43341329 GGAGAGAGGGAGAAGGGGGAAGG + Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157249156 18:46078944-46078966 CATGAATGGGGGGAGGGGGGAGG + Intergenic
1157317119 18:46601522-46601544 CAGGAAGGGGAGGAGGGGGTGGG - Intronic
1157470163 18:47982618-47982640 GGAGAAGGGGAGAAGGGGGAGGG + Intergenic
1158591428 18:58782131-58782153 CTAGAAATGGAGAAGAGGGATGG - Intergenic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158810024 18:61021423-61021445 CAAGTAAGGGAGAAAGGGGGTGG - Intergenic
1158828229 18:61248452-61248474 AATTAAAGGGAGAATGGGGTGGG + Intergenic
1158855845 18:61542767-61542789 CATGCATGGAGGAAGGGGGAAGG + Intronic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159477106 18:68935819-68935841 GAGGGAAGGGAGAAGAGGGAAGG + Intronic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1159905873 18:74091790-74091812 CATTAAAGGCAGCTGGGGGAAGG - Intronic
1159964064 18:74579170-74579192 AAGGAAAGGGAGAAGGGAGAAGG - Intronic
1160029345 18:75244957-75244979 CAAGAGAGAGAGATGGGGGAAGG - Intronic
1160178645 18:76615895-76615917 CAGGGAAGGTGGAAGGGGGATGG + Intergenic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160294364 18:77623887-77623909 CGTGGAAGGGGGAAGGGGGAAGG - Intergenic
1160949726 19:1659690-1659712 CCTGAAAAGGACAAGGGGGCTGG - Intergenic
1161228998 19:3163123-3163145 CACGCAAGGGAGTCGGGGGACGG + Exonic
1161248808 19:3269757-3269779 CAAAAAAGGGAGAGGGGGAAGGG - Intronic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162078572 19:8205401-8205423 GATGAATAGGAGAAGAGGGAGGG - Intronic
1162729997 19:12712711-12712733 CATACAAGGCAGAAGGGGCAGGG - Intronic
1162818114 19:13208158-13208180 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
1162866125 19:13548471-13548493 GATGAAAGTGGGGAGGGGGATGG + Intronic
1163455641 19:17404347-17404369 TGAGAAAGGGAGAAGGGAGAGGG - Intronic
1164053227 19:21600672-21600694 AAAGAAAGGTAGGAGGGGGAGGG - Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164805484 19:31113065-31113087 AGTGGAAGGGGGAAGGGGGAAGG + Intergenic
1164867009 19:31612819-31612841 CATGAAATGGATAAGGGAAATGG - Intergenic
1165026988 19:32969459-32969481 CATGAATGGCAGCAGGAGGAAGG - Intronic
1165418588 19:35711020-35711042 CCTAAAAGGGAGGAGGGGCAAGG - Intronic
1165561729 19:36686306-36686328 AAGGCAAGGGAGAAGGGGTAAGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166297675 19:41896953-41896975 GAGGAAAGAGAGGAGGGGGAAGG - Intronic
1166321448 19:42021704-42021726 CAAAAAAGGGAGAGGCGGGAAGG + Intronic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166332450 19:42086800-42086822 CAGGAAAGAGAGGAAGGGGAGGG + Intronic
1166347964 19:42178047-42178069 GAGGAAAAGGAGAAGGGAGAGGG + Intronic
1166385617 19:42378909-42378931 TCTTAAAGGGGGAAGGGGGAAGG + Intergenic
1166395053 19:42433530-42433552 CAGGAAAAGGATAAGGGGCAGGG + Intronic
1166411381 19:42557666-42557688 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166990641 19:46690557-46690579 CATGAAAGGAAGAAGCAGAAAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167407873 19:49325461-49325483 CATGTAAGGAAGAAGAGGGTAGG + Intergenic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168059608 19:53883476-53883498 GCTGAAGGGGGGAAGGGGGAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168657673 19:58142832-58142854 GATGAGAGGGAGAAGGAGAAAGG - Intronic
925056360 2:860550-860572 CATGGAGGGGAGAGGGTGGAGGG - Intergenic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925947220 2:8876705-8876727 AAGGAAAGGGGGAAGGGGGAAGG + Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926548015 2:14266196-14266218 CAAGAAAGGGAGCAGGTGGACGG + Intergenic
926562860 2:14436471-14436493 GAGGAAAGGGAGAAGGGAGAGGG + Intergenic
926644945 2:15280367-15280389 GGTGAATGGGAGAAGGGAGAAGG + Intronic
926828382 2:16932768-16932790 CAGAAAAGGGGGAAGAGGGAAGG - Intergenic
927481399 2:23456986-23457008 CATGGAAGGGAGCAGGGTGGCGG + Intronic
927705722 2:25295255-25295277 CATGATAGGGAGGCGGGGGCTGG - Intronic
927785056 2:25968126-25968148 AATGAAAGAGACAATGGGGAGGG + Intronic
928076441 2:28269275-28269297 GATGGAGAGGAGAAGGGGGAAGG - Intronic
928105838 2:28470082-28470104 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
928136789 2:28693795-28693817 CATCCAAGGGGGAAGGAGGATGG - Intergenic
928246033 2:29627661-29627683 CTTGAAGGGGAGATGGGGGTGGG + Intronic
928766218 2:34649361-34649383 CTTGAAAGGGAGAAAGGACATGG - Intergenic
929071692 2:38038053-38038075 AATGGAGGGGAGAAGAGGGAAGG - Intronic
930058564 2:47270597-47270619 CTTGATAGGGAAAAAGGGGATGG + Intergenic
930083996 2:47480037-47480059 GGAGAATGGGAGAAGGGGGAAGG - Intronic
930186073 2:48413420-48413442 TATGCAAGGGAGCAGAGGGAAGG - Intergenic
930679820 2:54245031-54245053 GAGGATAGGGAGATGGGGGAAGG - Intronic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
930871773 2:56178409-56178431 GAGGAAAGAAAGAAGGGGGAAGG - Intergenic
930946571 2:57083790-57083812 CAAGAAGGAGAGAAGGGAGAAGG - Intergenic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931427694 2:62185930-62185952 CAGGATAGGGTGGAGGGGGAGGG - Intergenic
931630789 2:64296666-64296688 CATCATAGGGAGGAAGGGGAGGG + Intergenic
932088128 2:68780598-68780620 AAGGAAGGGGAGAAGGGGGAAGG - Intronic
932342435 2:70974790-70974812 CATGAATGGGAGCAGGGTGGGGG - Intronic
932369684 2:71176793-71176815 AAAGAAGGGGAGAAGGAGGAAGG - Intergenic
932568175 2:72922498-72922520 CATCACAGGGAGATGGGTGAGGG - Intronic
933182552 2:79243771-79243793 GAGGGAAGGGAGAAGGGGTAAGG + Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933295284 2:80483228-80483250 AATGAAAGAAAGAAGGGAGAGGG - Intronic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
934666828 2:96177682-96177704 CAAGAAAGGGAGAATGGAAATGG - Intergenic
935142806 2:100368862-100368884 ACTGAAGGGGAGATGGGGGAAGG + Intergenic
935155275 2:100478982-100479004 CATCCAAGGGAAAAGGTGGAGGG - Intronic
935354769 2:102187830-102187852 CAAGGAAGGGAGAAGAGGGTGGG - Intronic
935505263 2:103892440-103892462 TATGAATTGGAGGAGGGGGAGGG + Intergenic
935599384 2:104907114-104907136 CATGTTAGAGAGATGGGGGAAGG - Intergenic
937311096 2:120903953-120903975 CAGGAAGGGGAGATTGGGGAGGG + Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937335983 2:121062621-121062643 CATGAAATGGAGAAGCCGGTGGG - Intergenic
937554818 2:123141035-123141057 TGTGGTAGGGAGAAGGGGGAGGG - Intergenic
937624434 2:124026712-124026734 CATGACAGGGATAAGGGATATGG - Intronic
937635831 2:124154351-124154373 CAAGAAAGGAAGAAAGGGCATGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938541194 2:132285364-132285386 TATGAATGGGAGAAGGCAGAAGG + Intergenic
939010297 2:136838620-136838642 TTTGAAAGGGAGGATGGGGAAGG - Intronic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940656116 2:156489805-156489827 CAGGAAAGAGGGAAGAGGGAGGG - Intronic
941099271 2:161278965-161278987 CATGAAAGAGAGAGGGCAGAAGG - Intergenic
941108897 2:161395541-161395563 CTTGAAAGGGACAAGGAGTAAGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941700553 2:168600082-168600104 AAGGAAAGGAGGAAGGGGGAGGG - Intronic
942744242 2:179213531-179213553 CCTGAAAGTGAGAAGGAGAATGG + Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
942941053 2:181618114-181618136 CAAGAGAGTGAGAAGGGGGTGGG + Intronic
943195760 2:184746692-184746714 CTGGAAAGGGTGATGGGGGAGGG - Intronic
943370430 2:187009631-187009653 AATAAAATGAAGAAGGGGGAAGG - Intergenic
943671878 2:190671683-190671705 CATGGAACTGAGAAGCGGGAAGG - Intronic
943696932 2:190946681-190946703 GAAGAAAGGGAGAAGATGGAGGG - Intronic
944483698 2:200182002-200182024 CTTGGAAGGGGGAAGGGGCAGGG - Intergenic
946014283 2:216591563-216591585 CATGGGAGGGAGCAGTGGGAAGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946310182 2:218878957-218878979 CATGGTAGGGAGAGTGGGGAGGG + Intergenic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
947004810 2:225498846-225498868 CATTAGAGGGAAAAGGGAGATGG + Intronic
947257852 2:228184878-228184900 TATTAAAGGGAGAAGGGTAAAGG + Intergenic
947323763 2:228952235-228952257 CCAGAGAGGGAGAAGAGGGAGGG + Intronic
947349638 2:229229775-229229797 CAGGAAAGGGAGAAGACGGGTGG - Intronic
947628176 2:231634451-231634473 AAAGAAAGAAAGAAGGGGGAGGG + Intergenic
947973204 2:234342116-234342138 CATGGAACGGGGAGGGGGGATGG - Intergenic
947984416 2:234436678-234436700 TATGCAAGGGAGAAGGAGCAGGG - Intergenic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
1168754251 20:305140-305162 CATGGAAGGGAGAAAGGGCGTGG + Intergenic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168987903 20:2066154-2066176 CCAGACAGGGAGAATGGGGAAGG + Intergenic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169062957 20:2674842-2674864 CAAAAAAGGGGGATGGGGGAGGG - Intergenic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169404373 20:5311283-5311305 CAGGATAGGGAGAAAGGGTAAGG + Intronic
1169570264 20:6898533-6898555 CATGAAAAGAAGGAGGGAGAGGG + Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1170034164 20:11972625-11972647 GAAGAAAGGGAGAAAGGGCATGG - Intergenic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1170938240 20:20827860-20827882 AAGGAAGGGGAGGAGGGGGAAGG + Intergenic
1171356308 20:24548010-24548032 CACTGAAGGAAGAAGGGGGAAGG + Intronic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1171778036 20:29389066-29389088 GATGAAGGAGAGAAGGAGGAGGG - Intergenic
1171990058 20:31689228-31689250 AAGGAAAGGAAGAAAGGGGAAGG + Intronic
1172160817 20:32866752-32866774 GAGGAAGGGAAGAAGGGGGAGGG - Intronic
1172358950 20:34298994-34299016 CATATAAGGCAGAAGGGGCAGGG - Intronic
1172931940 20:38592497-38592519 CAGCAAAGGGAGATGGGGGTGGG + Intergenic
1172956949 20:38767536-38767558 CATGAAAGCCAGAATGGAGAAGG + Exonic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173494989 20:43512170-43512192 CAGGAAAGGAAGCAGGGAGATGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174306031 20:49614937-49614959 AAACAAAGGGAGAACGGGGAGGG + Intergenic
1174410079 20:50329654-50329676 CATGAATGGAAGGAAGGGGAGGG - Intergenic
1174423903 20:50418577-50418599 GAAGAAAGGGAAAAGGGGAAAGG + Intergenic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1174713969 20:52737029-52737051 CAAGAAAGGGAGAAGCTGGAGGG + Intergenic
1174817283 20:53697695-53697717 AAGGAAAGGGAGAGGAGGGAGGG + Intergenic
1174846617 20:53949063-53949085 CATGAAAATGGGAAAGGGGAAGG + Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175281985 20:57809953-57809975 CATGAAAGGCACAGTGGGGACGG - Intergenic
1175551617 20:59821585-59821607 TAAGAAGGGGAGAAGGGAGATGG + Intronic
1175616640 20:60405359-60405381 TTTGGAATGGAGAAGGGGGAAGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176276357 20:64272107-64272129 CAGGAAAGGTTGAAGGGAGAAGG + Intronic
1177235006 21:18377388-18377410 CATCAAACTCAGAAGGGGGAAGG + Intronic
1177513553 21:22120654-22120676 CATGAAAGAGAGAGGTGGCAGGG + Intergenic
1177670210 21:24214739-24214761 AAGAAAAGAGAGAAGGGGGAGGG + Intergenic
1177825764 21:26081314-26081336 CAGGAAAGGGAGATGGGGTAGGG + Intronic
1177839006 21:26216071-26216093 CAAGAAAAGGACAAGGGGAAAGG - Intergenic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178240572 21:30894930-30894952 GATGAAGGGGAGGTGGGGGAGGG - Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178750404 21:35297230-35297252 CATGAAAGGGACAACATGGATGG - Intronic
1178810241 21:35875065-35875087 CATGAAAGGGCAGAGGGTGATGG + Intronic
1179062075 21:37988530-37988552 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1181151043 22:20883773-20883795 CATGAAAGTGAGAGGTGGGGAGG - Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181844769 22:25698235-25698257 GAAGAAAGGGAGAAAAGGGAAGG + Intronic
1181957274 22:26597062-26597084 AATGAAAGTGAGATGAGGGAAGG + Intergenic
1182082445 22:27538892-27538914 CAGGGAAGGAGGAAGGGGGAGGG - Intergenic
1182122098 22:27794890-27794912 GATGAGAAGGGGAAGGGGGAGGG + Intronic
1182131396 22:27855388-27855410 AATGAAAGGGAGAAAAGGCAAGG + Intronic
1182471236 22:30549622-30549644 CATGAAGGGGGGAAGGGAGAAGG - Intergenic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182680731 22:32077423-32077445 CTTAAAAGAGAGTAGGGGGAAGG - Intronic
1182842724 22:33404785-33404807 CAAGTAAGGGGGAAGGGGGTTGG + Intronic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183350275 22:37331038-37331060 CAGGCCAGGGAGGAGGGGGAAGG - Intergenic
1184106282 22:42369177-42369199 AGAGAAAGGGAGAAGGGGGTGGG - Intergenic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184975466 22:48058512-48058534 CAAGAAAGGATCAAGGGGGAAGG + Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949214281 3:1546583-1546605 CAAGCAAGGGAGAATGAGGAGGG + Intergenic
949273290 3:2246705-2246727 CATGAAAAGGAGAGAGGGGATGG + Intronic
949581102 3:5389322-5389344 CATGAAAGGGTGGAGGGAGGGGG - Intergenic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950085564 3:10255023-10255045 CAGGAAAGGAGGGAGGGGGAGGG - Intronic
950155641 3:10719676-10719698 CATGAATGGGAGAGAGAGGAAGG + Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950521113 3:13498608-13498630 CCTGAAAGGGGGCTGGGGGAGGG + Intronic
950584621 3:13883441-13883463 CATCTAATGGAGGAGGGGGAAGG + Intergenic
951268960 3:20602439-20602461 CAGGAAAGAGAGAAGAGTGAAGG - Intergenic
952133341 3:30389583-30389605 CCTGAAGGGGAGAAGGGCCATGG - Intergenic
952245030 3:31578682-31578704 CATGGAAGGAGAAAGGGGGAGGG - Intronic
953226713 3:41028127-41028149 CATGGAAGAGTGGAGGGGGAAGG + Intergenic
953335364 3:42089706-42089728 CAGGAAAGGGAGATGGGGAAAGG - Intronic
953553535 3:43923898-43923920 AATGAAAGGGGAAGGGGGGAAGG - Intergenic
953782952 3:45887615-45887637 CAGGAAAGGGAGTAAGGAGATGG - Intronic
953833816 3:46326191-46326213 AAAGATAGTGAGAAGGGGGATGG - Intergenic
954237984 3:49271671-49271693 CAAGAAAGGTATAAGTGGGAGGG + Intronic
954366640 3:50149995-50150017 CATGAAAGTGGTAAGGGTGAAGG - Intergenic
954440046 3:50516803-50516825 CAGGCATGGGAAAAGGGGGAAGG - Intergenic
954992749 3:54855191-54855213 CAGGAAATGGAGAGAGGGGAGGG + Intronic
955395889 3:58556909-58556931 CAGGGAAGGAGGAAGGGGGAAGG + Intergenic
955566225 3:60249715-60249737 CACACACGGGAGAAGGGGGAAGG + Intronic
955935321 3:64097476-64097498 CATTAAGGGGAGGAGGAGGATGG + Exonic
956184896 3:66553055-66553077 CATGACCGGGAAGAGGGGGAGGG - Intergenic
957154746 3:76533677-76533699 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957155364 3:76537780-76537802 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958734565 3:97993749-97993771 AAGGAAAGGGAAGAGGGGGAGGG - Intronic
958927149 3:100171341-100171363 CTTGAAAGGGGGAAGAGGGGGGG - Intronic
958996608 3:100912960-100912982 GATGAAGGGGAGAAGGGAGAGGG + Intronic
959105116 3:102056989-102057011 GGAGAAAGGGAGAATGGGGAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959598931 3:108157291-108157313 GATGAGAGGGACATGGGGGAAGG - Intergenic
960048416 3:113218876-113218898 CAACAATGGGAGAAGGGGGGTGG + Intronic
960319009 3:116211177-116211199 CAGGGATGGGAGGAGGGGGAAGG + Intronic
960363062 3:116737195-116737217 CTTGAAAAGGAGAAGAGGCAAGG + Intronic
960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG + Intronic
960974695 3:123162792-123162814 CTTTAAAGGGAGATTGGGGAGGG - Intronic
961117392 3:124342307-124342329 CCGGAAAGGGAGAAGGGGCTGGG - Intronic
961166885 3:124769715-124769737 TCTGAGAGGGAGAAGGGGGCTGG - Intronic
961498658 3:127315030-127315052 CAAGAAAGAGAGAGAGGGGAGGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961660274 3:128464942-128464964 GAGGGAAGGGAGAAGGGGGAAGG - Intronic
961881521 3:130064851-130064873 CAGGAAAGGGAGATAGGGGTGGG - Intergenic
962007741 3:131364089-131364111 CCTGAAACTGAGAAGGGGTAAGG + Intergenic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962744932 3:138390020-138390042 CAAGAAGGGGAGAAGGGAGGAGG + Intronic
962759913 3:138501433-138501455 CAGGGAAGGGAAAATGGGGAAGG - Intronic
962815591 3:138994955-138994977 CATCAAGGGGAGAAAGGAGAAGG - Intergenic
963114488 3:141714729-141714751 CATGAAAGAAAGAAAGGGAAGGG + Intergenic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
963605491 3:147409317-147409339 GATGAATGGGAGCAGGGGGGAGG - Intronic
964680395 3:159331611-159331633 CGTGAGAGGAAGTAGGGGGATGG - Intronic
964878182 3:161393807-161393829 AATGAAGGAGAGAAGAGGGAAGG + Intergenic
965318273 3:167218037-167218059 CTTGAAAGTGAGAAAGGGGCCGG - Intergenic
965409028 3:168306488-168306510 CAGGAAGGGGAGTAAGGGGATGG + Intergenic
965961979 3:174440246-174440268 GAGGGAAGGAAGAAGGGGGAAGG - Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966197029 3:177323953-177323975 TATGAAAGGGAGAAGGGGAGAGG - Intergenic
966211183 3:177454928-177454950 CATGAAGGGAAGAAAGAGGAAGG - Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966314508 3:178630684-178630706 CAAGAAAAGGAGAAGGGAGGAGG - Intronic
967095524 3:186174416-186174438 AATGAAAGGGAGGGAGGGGAAGG + Intronic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967409041 3:189148888-189148910 CAGGAACGGGAGAAATGGGATGG - Intronic
968719799 4:2193126-2193148 TATGAATGGGAGAATGGTGAGGG - Intronic
968862813 4:3185948-3185970 AATGGAAGGGAGGAAGGGGAGGG + Intronic
969179303 4:5424817-5424839 CAAGAAGGAGAGAAGGGAGAAGG + Intronic
969637347 4:8377008-8377030 CATGGAAGGTGGAAGGAGGAAGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970099147 4:12501342-12501364 AAAGAAAAGGAGAAGGGGAAGGG + Intergenic
970479326 4:16457734-16457756 AAAGAAGGGAAGAAGGGGGAGGG - Intergenic
970506336 4:16734547-16734569 GATGGAAGGGAAATGGGGGAAGG - Intronic
970947684 4:21714413-21714435 AAGGAAAGGGACAAGGGGAAGGG + Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971114285 4:23626336-23626358 GATGAGAGGGAGAAGGGCAAAGG + Intergenic
971174462 4:24267423-24267445 CATTTAAGGGTGAAGGGGAAAGG - Intergenic
971284393 4:25273700-25273722 GAGGAATGGGAGAAGAGGGAAGG - Intronic
971443179 4:26712460-26712482 CATGAAAGAGAGAAGCAGCAGGG - Intronic
971478793 4:27096095-27096117 AAGGAAAGGGAGAAGGGAGGAGG - Intergenic
971834690 4:31748247-31748269 CATGTGAGGGAGGTGGGGGAGGG - Intergenic
972265511 4:37455192-37455214 GATTAAATGGGGAAGGGGGAGGG - Intronic
972356549 4:38284518-38284540 AATGAAAGGGGGATGGGGGTGGG + Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
975460856 4:74651272-74651294 GATGGGAGGGAGGAGGGGGAGGG + Intergenic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976267255 4:83195755-83195777 AAAGAAAGGAAGAAGGTGGAAGG - Intergenic
976822285 4:89220044-89220066 CATGGATGGGAGTAGGGGGTGGG - Intergenic
976987861 4:91325388-91325410 GATGAAAGGGAGCAAGGGGTAGG + Intronic
977347109 4:95830047-95830069 CATGTAAGTGAGAAAGGAGAAGG + Intergenic
978149576 4:105416809-105416831 TATGAAAAGGAGAATGGAGAAGG - Intronic
978663356 4:111154105-111154127 CAAGAAAGAGAGAAGAGAGAAGG - Intergenic
979398147 4:120214471-120214493 TATGCAGGGGAGAAGGGGGATGG + Intergenic
979768393 4:124491119-124491141 GAAGAAAGGGGGGAGGGGGAGGG + Intergenic
979771057 4:124525400-124525422 CATGGGAGCTAGAAGGGGGATGG - Intergenic
979968656 4:127107364-127107386 CCTGAAAGAGATAAGGAGGATGG + Intergenic
980483722 4:133425459-133425481 GATGAAAAGGAGTAGGGGAAAGG - Intergenic
980843148 4:138291190-138291212 TTTCAATGGGAGAAGGGGGAGGG - Intergenic
981086446 4:140689410-140689432 AAGGGAAGGGAAAAGGGGGAAGG - Intronic
981086487 4:140689508-140689530 AATGGAAGGGAAAAGGGGGAAGG - Intronic
981093645 4:140757078-140757100 AATGGAATGGAGAGGGGGGAGGG - Intergenic
981471001 4:145134778-145134800 CACCAAAGGGAAAAGGGGGCTGG + Exonic
981912267 4:149995440-149995462 GAAGGAAGGGAGGAGGGGGAAGG + Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
984011947 4:174381961-174381983 CATGTATGGTAGAAGGTGGAGGG + Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984803297 4:183733779-183733801 CAGAAAAGGAAGAAAGGGGAAGG - Intergenic
984911446 4:184676949-184676971 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
985812728 5:2101957-2101979 CATGTAAGGGAGAGGTGGGCAGG - Intergenic
985993751 5:3584819-3584841 AATGAAAGGAAGAAGGGGGGAGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986661468 5:10063832-10063854 CAGGAATGGGAGAACAGGGAAGG + Intergenic
987018266 5:13843402-13843424 GAGCAAAGAGAGAAGGGGGATGG - Intronic
987373354 5:17213084-17213106 TATGAAAGGGAGAACGGGGTTGG + Intronic
987603868 5:20107906-20107928 CAAGAAAGGGGGAGGGGGGAGGG - Intronic
988382758 5:30519146-30519168 AATTAAAGAGAGAAGAGGGAGGG + Intergenic
988392916 5:30658879-30658901 CATGGATGGTGGAAGGGGGATGG + Intergenic
988485566 5:31665641-31665663 CAGGAAAGGGAGGGGGGGGAGGG - Intronic
989278860 5:39619470-39619492 CAAGAAAGAGAGAAGAGAGAAGG + Intergenic
989321791 5:40143460-40143482 ATTGAAAGGGAGAAGGGTGTTGG - Intergenic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989981756 5:50654154-50654176 CAAGAAAGAGAAAGGGGGGAGGG + Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990257969 5:53991191-53991213 AATGAAAGGGAGCCGGGGCATGG + Intronic
990366086 5:55071290-55071312 CATGAAAGTGAGATGAGGGAGGG + Intergenic
990416851 5:55595090-55595112 CACGTAAGGGAGGAGAGGGAAGG + Intergenic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
991517251 5:67451193-67451215 CATGAAAGTGTGGAGGGGGTGGG - Intergenic
991563954 5:67985254-67985276 GATGAAGTGGAGAAGGTGGAAGG + Intergenic
992116006 5:73539177-73539199 CATCAAGAGGAAAAGGGGGAAGG - Intergenic
992457502 5:76929233-76929255 CATGGCAGAGAGAAGGGTGAAGG + Intergenic
992523818 5:77585824-77585846 GAAGAAAGGGAGGAGGGCGAGGG + Intronic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
992786453 5:80174761-80174783 CAAGCAAGGGAGTAGGGGCAGGG + Intronic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
994285517 5:97960497-97960519 AAGGAAACAGAGAAGGGGGAAGG + Intergenic
994303445 5:98174434-98174456 CATGAAAGGTATAAAGGAGATGG + Intergenic
994312539 5:98291760-98291782 CAAGAAAGGGAGATGAGGCAAGG - Intergenic
994356215 5:98796545-98796567 GAAGAAAGGGAGTCGGGGGAGGG + Intronic
994903221 5:105802975-105802997 CATGGAAGGGAGATAGGGGTGGG - Intergenic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
996058840 5:119010484-119010506 CATGTAATGCAGAAGGGGGGAGG - Intergenic
996371926 5:122762610-122762632 TCTGAAAGGGTGAAAGGGGATGG - Intergenic
996387597 5:122925263-122925285 GAAGGAAAGGAGAAGGGGGAGGG - Intronic
996426757 5:123321087-123321109 GATGTATGGGAGAAGGGGCATGG + Intergenic
996876938 5:128250570-128250592 CAAGAACGGCAGGAGGGGGATGG - Intergenic
997397272 5:133572854-133572876 CATGAAAGGCAGAAGAGAAAAGG + Intronic
997948279 5:138221522-138221544 CATGAAAGTTAGAAGGGAGAGGG + Intergenic
997956340 5:138281400-138281422 CATGAAAGTTAGAAGGGAGAGGG + Intergenic
998443360 5:142180082-142180104 CTTGTAAGGGGGAAGGGAGAAGG - Intergenic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
998978271 5:147672179-147672201 CATGAAAGAGTGAAGGATGAAGG - Intronic
999055843 5:148575348-148575370 AAAGAAAGGGAGAAGGGAGGGGG - Intronic
999245835 5:150154219-150154241 CCAGAAAGGGGGAAGAGGGAGGG + Intronic
999273894 5:150315551-150315573 CGGGAAAGGGAGAATGGAGAGGG + Intronic
999385929 5:151154534-151154556 CAAGAAAGGGCAAAGAGGGAAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000330521 5:160201675-160201697 GAAGAAAGAGAGGAGGGGGAGGG - Intronic
1000727016 5:164784380-164784402 AGAGAAAGGGGGAAGGGGGAAGG + Intergenic
1001189547 5:169615697-169615719 CAGGAGAGGGAGAAGAGTGAAGG - Intergenic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001439922 5:171734819-171734841 CAAGCAAGTGAGAAGGTGGAAGG - Intergenic
1001970327 5:175950145-175950167 CTTGAAAGGTGGAAGGAGGAGGG - Intronic
1002161220 5:177315023-177315045 CTTGCAGGGGAGAAGGGGAAAGG - Intergenic
1002805412 6:568950-568972 CATGAAAAGTAGACGGGGAAGGG + Intronic
1002928685 6:1619463-1619485 CCTGAGAGGGGGGAGGGGGATGG - Intergenic
1003191649 6:3880121-3880143 CATGCCAGGGAGGAGGGAGATGG - Intergenic
1003423548 6:5980093-5980115 CATGAAAGGGCTAAGGGGGGAGG + Intergenic
1003923706 6:10857107-10857129 CATGATAGAGAGAACGGGGTGGG + Intronic
1003924098 6:10860673-10860695 CAAGAGAGGGAGTTGGGGGAAGG + Intronic
1004020237 6:11770436-11770458 CAGGAAAGGGAGAGAGGAGAGGG + Intronic
1004173547 6:13318290-13318312 CATGACTGGGAGACGTGGGATGG + Intronic
1004354795 6:14921562-14921584 CAAATGAGGGAGAAGGGGGAAGG + Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1004755630 6:18607737-18607759 CAAGAGAGGAAGAAGGGAGAAGG + Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005620562 6:27616303-27616325 GATGAAAGGGAGAATGCTGAAGG - Intergenic
1006029051 6:31165812-31165834 CATGAAGAGGAGTAGGGAGAGGG - Intronic
1006506781 6:34494243-34494265 CATGAAACAAAGAATGGGGATGG - Intronic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006756678 6:36422356-36422378 CCTGAAGGGGTTAAGGGGGATGG - Intronic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007193444 6:40039237-40039259 TATGACAGGAAGCAGGGGGATGG + Intergenic
1007217382 6:40250858-40250880 GATGAAAGGGAGATGGAGAAAGG + Intergenic
1007234422 6:40380022-40380044 CTTCAAAGGGGGAAGTGGGAGGG - Intergenic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007394677 6:41570680-41570702 CATGAAGGGGAGGTGAGGGAGGG - Intronic
1007697868 6:43744948-43744970 CATGAAAGGGAGCTGGAGGAGGG + Intergenic
1007870524 6:45031860-45031882 CATGAAAGGAAGTATGGGGTTGG + Intronic
1008264181 6:49403396-49403418 TATGAAAAGGAGAAAGGGAAAGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1009972773 6:70642765-70642787 CATGAAAAAGAGATGGGGCAAGG - Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010189103 6:73176313-73176335 GAAGAAAGAGAGAAGCGGGAGGG - Intronic
1010371630 6:75116577-75116599 GATGAAAGTGAGTAGGGGGCTGG - Intronic
1012334961 6:98044181-98044203 CATGAAAAAGAGAAAGGGGGAGG + Intergenic
1012689892 6:102297206-102297228 CAGCAAAGGGAGATGGGGGGGGG - Intergenic
1012760754 6:103297600-103297622 GATGGAAGGGAGAAAGGGGATGG - Intergenic
1013067807 6:106700458-106700480 CATTCAAGGGAGAAGGGCGAGGG - Intergenic
1013607134 6:111760887-111760909 CCAGAAAGGGAGAAGGCCGAGGG - Intronic
1013635252 6:112023083-112023105 GGGGAAAGGGAGAAAGGGGAAGG - Intergenic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1016199625 6:141392837-141392859 GAAGAAAGAGAGAAGGAGGAAGG - Intergenic
1016387232 6:143540285-143540307 CCTGAAATGGAGAAGAGGAAGGG + Intronic
1016865182 6:148759205-148759227 CAGGAGAGGGAGAAAGGGCATGG + Intronic
1017094964 6:150796735-150796757 TATGAAATGGGGAAGGGGCAGGG - Intronic
1017581462 6:155869138-155869160 CTTGAAAGAGAAAAGGGTGAGGG + Intergenic
1017637428 6:156456324-156456346 GAGGAAGGGGAGAAGGGGGAGGG - Intergenic
1017927763 6:158924819-158924841 AAGGAAAGGGACAAGAGGGAAGG + Intergenic
1018043745 6:159948040-159948062 GATGAAAGGAAGAAGGGGAGAGG - Intergenic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1018798288 6:167203746-167203768 GAAGAAAGGGGGAAGGAGGAAGG + Intergenic
1019346328 7:532586-532608 CGTGAAAGGGAGATGAGGGCAGG - Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020032935 7:4945569-4945591 AAAGGAAGGGAGAAAGGGGAGGG - Intronic
1020091429 7:5344460-5344482 CATGAGAGCGAGGAGGGGGAAGG + Intronic
1020124308 7:5524527-5524549 CATGAATGGGGGCAGGGGGATGG + Intergenic
1020260557 7:6528581-6528603 GATGAGGGGGAGAAGGGAGAAGG + Intronic
1020911782 7:14140284-14140306 CATGAATGGGGGATGGGGGAGGG + Intergenic
1020967469 7:14889506-14889528 CTTGAAAAGGAGATGGGAGATGG + Intronic
1021065546 7:16167993-16168015 CATAAAAAGAAGAAAGGGGAAGG - Intronic
1021175427 7:17444400-17444422 CATGAAAGGGAGAGAAGGGTTGG - Intergenic
1021636992 7:22703644-22703666 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1021637857 7:22709190-22709212 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1022135660 7:27445681-27445703 GAGGAAGGGGAGAAGAGGGATGG + Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022253208 7:28629321-28629343 AAGGAAAGGGAGGAGGTGGAAGG - Intronic
1022274470 7:28841927-28841949 CAGGGAAGGGAGGAGGGGAAGGG + Intergenic
1022806645 7:33829264-33829286 CACTGAAGGGCGAAGGGGGATGG - Intergenic
1022935064 7:35166292-35166314 AAGGAAGGGGAAAAGGGGGAAGG - Intergenic
1023462269 7:40411610-40411632 CAGGAAAGGTAGCAGGGAGAGGG + Intronic
1023817118 7:43959673-43959695 CATGAGAGGGATAAGGGCGAGGG + Intergenic
1024212873 7:47221220-47221242 CATGAAAGGCTGAATGGAGAGGG + Intergenic
1024866418 7:53908953-53908975 GATGAAAGGGAGAAAGATGAAGG - Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1025935817 7:66035883-66035905 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1026158667 7:67850097-67850119 CTTGAAAGGAAAAAGGGGGCTGG - Intergenic
1026442793 7:70458644-70458666 CAACAAAGGGAGAAGGGAGGTGG - Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026742664 7:72988957-72988979 AAAGAAAGGGAGAAGTGTGAGGG + Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026802515 7:73409357-73409379 AAAGAAAGGGAGAAGTGTGAGGG + Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028779 7:74873662-74873684 AAAGAAAGGGAGAAGTGTGAGGG + Intergenic
1027101071 7:75376120-75376142 AAAGAAAGGGAGAAGTGTGAGGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027137052 7:75631915-75631937 CAGGAAATGGGGAAGTGGGAGGG + Intronic
1027230580 7:76269434-76269456 CAGAAAAGTGAGATGGGGGATGG + Intronic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1027509554 7:79062732-79062754 GATGACAGGGAGGAGGTGGAAGG - Intronic
1027617030 7:80436093-80436115 CAAGAAAGAGAGAAGGTGGGGGG - Intronic
1028592413 7:92511988-92512010 GAGGAAAGGGAGAATGGGGTTGG - Intronic
1028633450 7:92961415-92961437 CATGAACACGATAAGGGGGAGGG - Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029351598 7:100016649-100016671 CAGGAAAGGGAGGGGAGGGATGG - Intronic
1029355468 7:100048530-100048552 CATGGATGGCAGGAGGGGGATGG + Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029538140 7:101167606-101167628 CATCCAAGAGAGAAGGGAGAGGG + Intergenic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1029831016 7:103259059-103259081 AAGGAAGGGGAAAAGGGGGAAGG - Intergenic
1029974036 7:104815889-104815911 CTTCAAAGGGGAAAGGGGGAGGG - Intronic
1030048939 7:105521703-105521725 AAAGAAAGGGAGGAGTGGGAAGG + Intronic
1030272512 7:107685613-107685635 CAGGAAAGGGAGTAGAGGGAAGG - Intronic
1030479268 7:110081886-110081908 CATGGATGGGGGCAGGGGGATGG + Intergenic
1030968334 7:116022021-116022043 TATGAAAGGCACAAGGGGAAGGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031972599 7:128075184-128075206 CATTGAAGAGACAAGGGGGATGG + Intronic
1032274406 7:130441373-130441395 CATAAAACGGAGCTGGGGGATGG - Intronic
1032436810 7:131907486-131907508 TATGGAAGGGAGAAATGGGATGG + Intergenic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032553927 7:132812101-132812123 AATGAAAGGGGGAAAGGGGGAGG - Intronic
1032699314 7:134364777-134364799 CAAGACAGGGAGAAGGGTGGGGG + Intergenic
1032746946 7:134795606-134795628 AAAGAAAAGGAGGAGGGGGAAGG - Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033322139 7:140349525-140349547 CATCAAAGGAAAAAGGGGGGGGG + Intronic
1033498876 7:141927428-141927450 CAATAAAGGGAGAAGGATGAAGG + Exonic
1033647583 7:143317086-143317108 TAGGAAAGGGGGAATGGGGATGG + Intronic
1034290023 7:149923007-149923029 GCTGAAAGGGAGAAAGGGGGAGG + Intergenic
1034928517 7:155142100-155142122 CGAGAGAGGGAGAAGAGGGAGGG - Intergenic
1035202818 7:157278052-157278074 CCTGAAAGGGTGAGGGGCGATGG + Intergenic
1035333435 7:158111178-158111200 AATAAAGGGGAGAAGGGAGAAGG + Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035476501 7:159147885-159147907 CATGACAGGGAGAGGGGGTTGGG + Intergenic
1036008943 8:4698710-4698732 GAAGGAAGGGAGAAGGTGGAAGG - Intronic
1036114969 8:5949176-5949198 CATGAAAGGGACCAGGTGGGAGG + Intergenic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1036740560 8:11357616-11357638 TATGAAAGGGAAAAGAGGCAGGG - Intergenic
1037805125 8:22054696-22054718 TATGAAAGGAAGTGGGGGGATGG + Intronic
1037822734 8:22142832-22142854 GATGCCAGGAAGAAGGGGGAAGG + Intergenic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038070332 8:24006259-24006281 GAAGGAAGGGAGAAAGGGGAAGG - Intergenic
1038531348 8:28320299-28320321 AATGAAAGGATGAATGGGGAAGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038782600 8:30580895-30580917 CATGAAAGGGAAAGGGGGGATGG + Intronic
1038869272 8:31476374-31476396 CATTAATGGGAGATGGAGGATGG + Intergenic
1039179855 8:34854399-34854421 GATTCAAGGGAGAAGGGAGAAGG + Intergenic
1039366818 8:36936833-36936855 CAACAAAGGTAGAAGGGGGGTGG + Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1041158096 8:55008761-55008783 CTTGTAAGGGAGAAAGAGGAAGG - Intergenic
1041518784 8:58731822-58731844 CATGAAAGGTAGAACAGGGCTGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1041775020 8:61514183-61514205 CAAGAATGGGAGCAGGTGGATGG - Intronic
1042833598 8:73057288-73057310 CATGAAAGTGACAAGGAGAATGG + Intergenic
1042884350 8:73531327-73531349 CATGAATGGGAGATGTGGCAAGG + Intronic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043393334 8:79812290-79812312 CCTGGAAGGGAGAAGGGGAAGGG + Intergenic
1043609625 8:82046001-82046023 ACTGAAGGGGAGATGGGGGAGGG - Intergenic
1043824654 8:84911670-84911692 CATGAAATGGGGGAGTGGGAAGG - Intronic
1043838250 8:85069030-85069052 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1044586030 8:93869808-93869830 CCTGAAGGGAAGAAGGGAGAAGG - Intronic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045127125 8:99104561-99104583 GATGAAAGGGAGAGGGGAGGGGG - Intronic
1045999098 8:108397841-108397863 AATGAAAGCGAGAAGGGTGAGGG - Intronic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1046934790 8:119875284-119875306 CAGCAAAGGGAGATGGGGAAGGG + Intronic
1047792270 8:128216387-128216409 AATGAAAGGTGGAAGAGGGAGGG - Intergenic
1047907006 8:129483142-129483164 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1047907030 8:129483199-129483221 GGAGGAAGGGAGAAGGGGGAAGG + Intergenic
1048029265 8:130615699-130615721 GCTGAGAGGGAAAAGGGGGAGGG - Intergenic
1048431496 8:134375693-134375715 GAGGAAAGGGAGAGGAGGGAAGG - Intergenic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1050103073 9:2138739-2138761 CATGAAATGGGGAAAGGGGTAGG + Intronic
1050281596 9:4055984-4056006 CATGATGGGGAGAATGGTGAAGG + Intronic
1050301298 9:4261370-4261392 GAAGAAAGGGAGACAGGGGAGGG + Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050763346 9:9101440-9101462 CATGAAATCAAGAATGGGGATGG + Intronic
1051425228 9:16925632-16925654 CTTGAAAGGCTGAAGTGGGAGGG + Intergenic
1051686200 9:19660500-19660522 CAAGAAAGGGAAAATTGGGAAGG + Intronic
1051759021 9:20439586-20439608 CAGGAAGGGGAGTGGGGGGATGG + Intronic
1052537856 9:29770618-29770640 AAAGAAAGGGAGAAGGGGAGTGG + Intergenic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053286415 9:36852230-36852252 GATCAAAGGGTGAAGGGGCAGGG - Intronic
1053424646 9:38003177-38003199 GATGAGAGTGAGAAGGGGGCAGG + Intronic
1054770238 9:69076815-69076837 CCAGCAAGGGAGAAAGGGGAAGG + Intronic
1054793867 9:69280590-69280612 GATGGAAGCCAGAAGGGGGAAGG - Intergenic
1055104381 9:72497310-72497332 GATGAAAGGGAGAAGTGAGTTGG + Intergenic
1055357665 9:75454128-75454150 CATGATGGGGAGAAGGGCTAAGG + Intergenic
1055720584 9:79168828-79168850 CATTAAAGGGAAAAGGTGTATGG - Intergenic
1055976406 9:81959440-81959462 CATGAAAGGGTGCAGTTGGAGGG + Intergenic
1056218480 9:84428271-84428293 GATGAAGGGGAGAAAGAGGAGGG - Intergenic
1056334101 9:85549110-85549132 AAAGAAAGGGAAAAGAGGGAAGG + Intronic
1056366745 9:85912561-85912583 CAGGAAAGGGAGAGTGGGGAAGG + Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1056802974 9:89706952-89706974 CATGAAAGGCAGAGCTGGGAGGG + Intergenic
1056833659 9:89936428-89936450 CATGAGAGAAAGAAGGGGGTGGG + Intergenic
1057070092 9:92090233-92090255 CAAGAAAGGGGGAGTGGGGATGG + Intronic
1057161174 9:92889370-92889392 CATGAATGGGAGGAGGGTGGGGG - Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057703491 9:97381041-97381063 AAGGAATGGGAGAAGGGGCACGG - Intergenic
1058611811 9:106785734-106785756 GAGGAAAGGAAGATGGGGGAGGG + Intergenic
1058704613 9:107628055-107628077 CCTGAAAGGGGGAAGGGGACTGG - Intergenic
1058888166 9:109338746-109338768 AATGAGAGTGAGCAGGGGGAGGG - Intergenic
1059208880 9:112492509-112492531 CATGAAAGGCAGTAGGTAGAGGG - Intronic
1059448692 9:114356494-114356516 AAGGGAAGGGAGAAGGCGGAGGG - Intronic
1059490806 9:114666018-114666040 AAGGGAAGGGGGAAGGGGGAAGG - Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059986727 9:119827650-119827672 CATCAGAGAGAGAAGGGGCAGGG + Intergenic
1060566339 9:124595748-124595770 CATGAAATGGAGACATGGGAAGG - Intronic
1060967694 9:127720928-127720950 GAGGAAAGGAGGAAGGGGGAAGG - Intronic
1061294708 9:129670875-129670897 CAGGAAATAGAGAAAGGGGAAGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062437214 9:136551583-136551605 CGAGAAAGGGGGAAGGAGGAAGG - Intergenic
1203770550 EBV:47883-47905 ACTGAAAGGGACAAGAGGGACGG - Intergenic
1185450598 X:279010-279032 CAGCGAAGGGAGATGGGGGAGGG + Intronic
1186262362 X:7792790-7792812 CATTAAAGGGAGAATTGGCACGG + Intergenic
1186304785 X:8244545-8244567 CATGAAAGTGAGAACGGAGAAGG + Intergenic
1186327844 X:8498894-8498916 AAAGAAAGAGAGAGGGGGGAGGG + Intergenic
1186327862 X:8499074-8499096 AAGGAAAGCGAGAGGGGGGAGGG + Intergenic
1186456337 X:9712959-9712981 GATGAAAGGGGGCAGGGGGAAGG - Intronic
1186642268 X:11468409-11468431 GATGAAAGAGAGAAGGCAGAAGG - Intronic
1186846292 X:13534204-13534226 CAAGTGAGGGAGAAGGGGAAGGG + Intergenic
1186958354 X:14708001-14708023 CATGAAAGAAAGAAGGAGGGAGG - Intronic
1187308364 X:18117215-18117237 TCTGGAAGGGGGAAGGGGGAAGG + Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188245713 X:27833872-27833894 CATGAAAGGAAGATGGTGAACGG + Intergenic
1188438836 X:30194146-30194168 CAGGAAAGGGAGATGGGGTGGGG - Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188648255 X:32596133-32596155 CTTGAAAGGGAGAAAGGGGGTGG - Intronic
1188667504 X:32842537-32842559 CATGAAAGGGTGTATGGGGGGGG - Intronic
1189197148 X:39162259-39162281 GATGAAAGAGAGAAGAAGGAAGG - Intergenic
1189257532 X:39652143-39652165 CATGAAAGAGGGAATGAGGAAGG - Intergenic
1189680668 X:43512846-43512868 CATGGAAGGGAGAAAGGAGGAGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189935835 X:46067316-46067338 CAGCAAAGGGAGATGGGGGTAGG - Intergenic
1189953494 X:46255949-46255971 AATGAGAGGGAGATGGGGAAGGG + Intergenic
1190089694 X:47427018-47427040 AAGGGAAGGGGGAAGGGGGACGG - Intergenic
1190100450 X:47518728-47518750 CAAGAAATGGAGATGGGGAAGGG - Intergenic
1190453763 X:50606222-50606244 CATGAGGGGGGGAGGGGGGAGGG - Intronic
1190748178 X:53339028-53339050 GAAGAAAGAGAGATGGGGGAGGG + Intergenic
1190798854 X:53770236-53770258 GAAGAAAGAGAGATGGGGGAGGG + Intergenic
1191204198 X:57816941-57816963 GGTGAAAAGGAGAAGAGGGAGGG + Intergenic
1191770167 X:64747042-64747064 CAAGAGAGAGTGAAGGGGGAGGG + Intergenic
1191852357 X:65594813-65594835 CAAGAAAGAGAGATGAGGGAGGG + Intronic
1192184656 X:68938872-68938894 CAGGAAACTGAGAAGAGGGAGGG - Intergenic
1192312331 X:70027354-70027376 CACAAAAGGGAGTGGGGGGAGGG + Intronic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1192794651 X:74416886-74416908 TATGAAAGGGAGAAAAGGGTGGG + Intergenic
1193855091 X:86590955-86590977 CGGGGAAGGGGGAAGGGGGAGGG - Intronic
1195065668 X:101236128-101236150 TAGGAAAGGGAGAAGTGGGTGGG - Intronic
1195261698 X:103138469-103138491 GATGAAATGGGGAAGGGGGAGGG - Intergenic
1195469906 X:105219721-105219743 CATGAGTGGGAGCAGGGGGCAGG - Exonic
1195543616 X:106090054-106090076 CATGGAAAGGAGGAGAGGGAAGG - Intergenic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198118180 X:133564753-133564775 CATGAAAAGGTGAACAGGGATGG + Intronic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1199408903 X:147496383-147496405 CATGGAAAGGAGTGGGGGGAGGG - Intergenic
1199507921 X:148586948-148586970 TATGGAAGGGGGAAGGAGGATGG - Intronic
1199950984 X:152706145-152706167 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199953281 X:152722759-152722781 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199956401 X:152745691-152745713 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1199958698 X:152762316-152762338 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1200135784 X:153873925-153873947 CGAGGAAGGGAGAAGAGGGAGGG + Intronic
1201362191 Y:13164595-13164617 CAGCAAAGGGAGATGGGGTAGGG + Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201612010 Y:15853246-15853268 CATGAAAGTGATAAGGAGAATGG + Intergenic
1201612800 Y:15861651-15861673 CATGAAAGAGTCAAAGGGGAGGG - Intergenic
1202270966 Y:23073652-23073674 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202295060 Y:23347030-23347052 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202423961 Y:24707396-24707418 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202446828 Y:24962689-24962711 CAGAAAGGGAAGAAGGGGGATGG - Intergenic