ID: 1091585151

View in Genome Browser
Species Human (GRCh38)
Location 12:1811665-1811687
Sequence GCAAATTCTGGGCGGCAACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091585151_1091585157 3 Left 1091585151 12:1811665-1811687 CCGCGTTGCCGCCCAGAATTTGC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1091585157 12:1811691-1811713 GGAGGAATTCCAGCTTCATTTGG 0: 1
1: 0
2: 1
3: 18
4: 174
1091585151_1091585159 13 Left 1091585151 12:1811665-1811687 CCGCGTTGCCGCCCAGAATTTGC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1091585159 12:1811701-1811723 CAGCTTCATTTGGACGCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1091585151_1091585160 20 Left 1091585151 12:1811665-1811687 CCGCGTTGCCGCCCAGAATTTGC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1091585160 12:1811708-1811730 ATTTGGACGCCCGCGGCTACAGG 0: 1
1: 0
2: 0
3: 1
4: 10
1091585151_1091585161 21 Left 1091585151 12:1811665-1811687 CCGCGTTGCCGCCCAGAATTTGC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1091585161 12:1811709-1811731 TTTGGACGCCCGCGGCTACAGGG 0: 1
1: 0
2: 0
3: 0
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091585151 Original CRISPR GCAAATTCTGGGCGGCAACG CGG (reversed) Exonic