ID: 1091586739

View in Genome Browser
Species Human (GRCh38)
Location 12:1821180-1821202
Sequence AGACAGCCCCAAGAAACTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091586732_1091586739 15 Left 1091586732 12:1821142-1821164 CCAAGAGCCTTGTGCTGTCGTTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 107
1091586733_1091586739 8 Left 1091586733 12:1821149-1821171 CCTTGTGCTGTCGTTGTGCCCGG 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 107
1091586735_1091586739 -10 Left 1091586735 12:1821167-1821189 CCCGGCTCTGCACAGACAGCCCC 0: 1
1: 0
2: 1
3: 40
4: 500
Right 1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091586739 Original CRISPR AGACAGCCCCAAGAAACTCG GGG Intronic