ID: 1091588446

View in Genome Browser
Species Human (GRCh38)
Location 12:1829019-1829041
Sequence TCTCACATGGTGAATAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091588446 Original CRISPR TCTCACATGGTGAATAATTC AGG (reversed) Intronic
903000128 1:20259318-20259340 TCTCACATAGTGAAGAACCCAGG + Intergenic
908456538 1:64309846-64309868 TGTCACATGGTTGATTATTCTGG + Intergenic
909786066 1:79615427-79615449 TCCAAAATGGTGAATAATTTTGG - Intergenic
910602370 1:89045461-89045483 TCTCACATGGCAAACAATTGAGG - Intergenic
915009153 1:152668512-152668534 TCACACATGGTAAATAATGCAGG - Intergenic
915682654 1:157596392-157596414 GCTCTCAGGGTGAATAGTTCGGG - Intronic
918744833 1:188185981-188186003 TCTCTCATGGTGAATATCTTTGG + Intergenic
919487404 1:198161311-198161333 GATCACATGGTAAATATTTCTGG + Intronic
923849144 1:237774256-237774278 TCAAACATAGTGAATGATTCAGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063541924 10:6942720-6942742 TCTCACATCGTGTTTAATTTAGG + Intergenic
1063543595 10:6958642-6958664 ACTCACTTGCTGAATAATTTAGG + Intergenic
1063798318 10:9539158-9539180 ACTTACATGGTGAATAACTTTGG - Intergenic
1064739657 10:18419646-18419668 TGTCACATGGGAAAGAATTCAGG + Intronic
1065341533 10:24711259-24711281 TCTAAGATGCTGAAAAATTCTGG + Intronic
1066162659 10:32750794-32750816 TCTCACATTGTTTATCATTCAGG + Intronic
1068101670 10:52561931-52561953 TTTCACATGATGAATATTTCTGG - Intergenic
1069075429 10:64033893-64033915 TCACTGATGGTGACTAATTCCGG + Intergenic
1069179754 10:65343456-65343478 CATCACATGGTGCATATTTCAGG + Intergenic
1069369306 10:67729197-67729219 AATTACATGGAGAATAATTCTGG - Intergenic
1072008463 10:91282025-91282047 TCTCATATTATGAATAATACAGG - Exonic
1073672160 10:105604220-105604242 TGGCATATGGTGTATAATTCAGG - Intergenic
1078236926 11:9493682-9493704 TCACACATGGCATATAATTCTGG - Intronic
1078585021 11:12577648-12577670 TTTCACATGTTGAGTAATTCTGG + Intergenic
1078953005 11:16156526-16156548 TTTGACATGCTGAATTATTCAGG - Intronic
1082210910 11:49499544-49499566 TCACACATCTTCAATAATTCAGG - Intergenic
1085831272 11:79903667-79903689 TTTCAGATGGTAAATAAGTCAGG - Intergenic
1086104252 11:83132192-83132214 TTTCAAATGCAGAATAATTCGGG - Intergenic
1087194182 11:95288024-95288046 TCTCACAAGGTGAATTTTCCAGG + Intergenic
1087818807 11:102688574-102688596 ACTCATATGGTGAATATTTTGGG + Intergenic
1088073145 11:105814147-105814169 TAGCACATGGTGAAAAGTTCAGG + Intronic
1088171598 11:107004011-107004033 TATCACATGGTGATTAATCATGG + Intronic
1090968694 11:131621052-131621074 TCTCACATGCTACATCATTCAGG - Intronic
1091588446 12:1829019-1829041 TCTCACATGGTGAATAATTCAGG - Intronic
1092972888 12:13715175-13715197 CCTGACAGGGTGAATTATTCTGG + Intronic
1094638634 12:32251427-32251449 TCTCACTGGGTGAAAAATTAAGG + Intronic
1096363531 12:51008803-51008825 ATTCACATGGTTAAAAATTCAGG + Intronic
1097088363 12:56486399-56486421 TCTCCCATGGTGAATACCTGGGG + Intronic
1098823108 12:75258620-75258642 TCCCACCTGGTGAAGAATTTGGG - Intergenic
1099393406 12:82107818-82107840 TCTCACATGATCAATTATTGAGG - Intergenic
1101015701 12:100497794-100497816 TCTGACATAGTGAATAAAACAGG + Intronic
1106982129 13:35299738-35299760 TCTCAAATGGCAAAAAATTCTGG + Intronic
1108241864 13:48473368-48473390 TATCAATTGGTGAATCATTCGGG + Exonic
1108990293 13:56647924-56647946 TCTCACATAGTTAGCAATTCTGG - Intergenic
1109439924 13:62356750-62356772 TCTCACGTGAGAAATAATTCAGG + Intergenic
1111112130 13:83726627-83726649 TCTCACATCATGAATCATTATGG + Intergenic
1114529914 14:23389145-23389167 GCCCACATGGTGAATAAGGCTGG - Intronic
1115652840 14:35415489-35415511 TCTAACATGGGGAATACTCCAGG - Intergenic
1115922964 14:38397121-38397143 TATCATATAGTGAATAGTTCGGG + Intergenic
1118620068 14:67606968-67606990 TCTCACATTTTGAATATATCAGG - Intergenic
1123794594 15:23758811-23758833 TCTGACAGAGTGAATAATTCTGG - Intergenic
1124157689 15:27241741-27241763 TTTTCCAAGGTGAATAATTCAGG + Intronic
1125132545 15:36300559-36300581 TCTGAGACAGTGAATAATTCTGG + Intergenic
1125730941 15:41892529-41892551 TCTTGCCTGGTAAATAATTCAGG + Intronic
1127975727 15:63995876-63995898 ACACACATGCTGAATAATTTGGG - Intronic
1130035954 15:80361725-80361747 ACACACACAGTGAATAATTCAGG - Intronic
1130296513 15:82650130-82650152 TCTCACCTGGTTAAGACTTCAGG - Intergenic
1130692938 15:86101967-86101989 TCTCACATTGTTAATCATTGTGG + Intergenic
1137042760 16:35628361-35628383 TCTCACATAAGAAATAATTCAGG - Intergenic
1138150758 16:54654762-54654784 TGTCAAATAGTGATTAATTCAGG - Intergenic
1138360092 16:56421019-56421041 TCTCAGATGGTGAATATTTTAGG - Intronic
1138360128 16:56421331-56421353 TCTCAGATAGTGAATATTTTAGG + Intronic
1138891353 16:61148053-61148075 TTTTACATGGTGAATAATAGGGG + Intergenic
1139524553 16:67506423-67506445 TCTCACATGGTAAATATTAATGG + Intergenic
1140451478 16:75074441-75074463 TATCACATTGTGAATATTTATGG + Intronic
1149736902 17:59003689-59003711 TTTCATATGCTGAATAATTTGGG - Intronic
1151054268 17:71013422-71013444 TCTCAGCTGGAGATTAATTCTGG + Intergenic
1151837209 17:76589923-76589945 CCTCAGATGGAGACTAATTCAGG - Intergenic
1154007772 18:10547357-10547379 TCTTGCATGTTGAGTAATTCTGG - Intronic
1159428408 18:68319674-68319696 TCTCACCTGGTGAATTCTTAAGG - Intergenic
1161313428 19:3607148-3607170 GCCCAGATGGTGAATAATGCGGG - Intergenic
1165102259 19:33445919-33445941 TCTGCCACGGGGAATAATTCAGG - Intronic
1166335749 19:42105907-42105929 TTTCAGATGCTGAAGAATTCAGG - Intronic
928588370 2:32786507-32786529 TCTCACAGGGTGTAGAATTTTGG + Intronic
929927535 2:46228048-46228070 TCTCACAGGTTAAATATTTCTGG + Intergenic
931441537 2:62293807-62293829 TCTCCCGAGGTTAATAATTCAGG - Intergenic
932945330 2:76223024-76223046 AATCACATGATAAATAATTCTGG - Intergenic
933427621 2:82132566-82132588 TCTCACACAGGAAATAATTCAGG - Intergenic
933833787 2:86230316-86230338 CCTCCCCTGGTGAATTATTCAGG - Intronic
937827564 2:126383239-126383261 TGTCACATGGTAAATATTTCAGG - Intergenic
940118743 2:150239341-150239363 TTTAAAATGGTGAATATTTCTGG + Intergenic
941201601 2:162517924-162517946 TCTCCCTTGGTGAATATATCCGG - Exonic
945914253 2:215686012-215686034 TCTTTCATGTTGAATATTTCAGG + Intergenic
946827303 2:223691939-223691961 ACACACATGGTGAATAATTAGGG - Intergenic
1168802893 20:654568-654590 TCTCTAATTCTGAATAATTCTGG - Intronic
1168845512 20:941663-941685 TCTCACATGGGAAAGAATTCAGG + Intergenic
1168944559 20:1741752-1741774 TTTCACATGGTGAATATAGCAGG - Intergenic
1169158276 20:3353322-3353344 TCTCACAAAGTGAAGCATTCTGG - Intronic
1175606714 20:60317242-60317264 TCTAGCATGGAGATTAATTCTGG - Intergenic
1178192521 21:30301064-30301086 TCTCACATTCGGATTAATTCTGG - Intergenic
1179589286 21:42395410-42395432 TCCCCCATGGTGACTATTTCAGG + Exonic
949405427 3:3709034-3709056 TCTCACATAAGAAATAATTCAGG - Intronic
949455247 3:4231085-4231107 TCTGGCATGGTGAATTGTTCAGG - Intronic
950949791 3:16986313-16986335 ACTAACATAGTGAATAATTATGG - Intronic
954308657 3:49746941-49746963 TTTCAGATGATGAAAAATTCAGG + Intronic
955515839 3:59725691-59725713 TCTCACACAGTAAAGAATTCAGG + Intergenic
957007490 3:74967293-74967315 TCCTACTTGGTGAATAATTCTGG + Intergenic
960499571 3:118419805-118419827 TCTCACATGGTGAAAAATCAAGG - Intergenic
962119513 3:132546939-132546961 TCTCGCATGGGAAAGAATTCAGG + Intergenic
963357667 3:144230407-144230429 TGTCACCTGGTGAATAAAGCAGG - Intergenic
963588945 3:147231933-147231955 TTTCACATGGTGAATAATTTTGG - Intergenic
963909601 3:150804773-150804795 TTTCAAAGGGTGAATTATTCAGG - Intergenic
965502656 3:169474767-169474789 TCTCACCTGCAGAATCATTCTGG - Intronic
967114015 3:186320387-186320409 ACTCACATTCTGAATATTTCTGG + Exonic
967503700 3:190229100-190229122 TGTCACATGTTGAATAACTATGG - Intergenic
969148427 4:5144547-5144569 TGTCACATGGTGAGATATTCTGG - Intronic
971162938 4:24152360-24152382 TGACACATGGTGAATGATCCTGG + Intergenic
973634748 4:52851720-52851742 CCTATAATGGTGAATAATTCTGG - Intergenic
975262646 4:72321661-72321683 CCCCACATGTTGATTAATTCTGG - Intronic
976330440 4:83825279-83825301 TGTTACATGGTCAATAAGTCAGG + Intergenic
980778772 4:137469460-137469482 TCTCACATGATAAAAAATTCAGG - Intergenic
980800499 4:137743026-137743048 ACTTACATGGGGAACAATTCTGG - Intergenic
983467349 4:168111416-168111438 TCTCACATTTTGAAAAATTAAGG - Intronic
983983890 4:174034633-174034655 TCTAACATGGAAAATATTTCAGG - Intergenic
988569310 5:32348485-32348507 TCTCACATGAGAAAGAATTCAGG - Intergenic
988683441 5:33504699-33504721 CATCACATTTTGAATAATTCTGG - Intergenic
990659964 5:58002268-58002290 TCTCATAGTGAGAATAATTCTGG - Intergenic
991279722 5:64898732-64898754 TCTCTCATGCAGAACAATTCAGG + Intronic
992253452 5:74898398-74898420 TCTAATATCGTGAATATTTCAGG - Intergenic
992888552 5:81183159-81183181 TCTCACATGGTGAACTACCCAGG + Intronic
994943407 5:106354821-106354843 TTTTGCATGGTAAATAATTCTGG + Intergenic
995155394 5:108905914-108905936 TCTAACAGGGTGAAAAAATCTGG + Intronic
997218116 5:132131592-132131614 TTTCACTTGGTGTAGAATTCTGG - Intergenic
997394238 5:133545125-133545147 ACTCACATGGTTGATATTTCTGG - Intronic
1000385654 5:160672468-160672490 TGTCACATGAGGAATAATTGAGG - Intronic
1005235949 6:23762405-23762427 TATCAGATGATGAAAAATTCTGG - Intergenic
1007928186 6:45667214-45667236 ACTCACATGGTGTATGAGTCCGG + Intergenic
1008186108 6:48392601-48392623 TTTGTCATGGTGTATAATTCTGG - Intergenic
1008311326 6:49978128-49978150 ACTCTCATGGGGAATATTTCTGG + Intergenic
1011183080 6:84643373-84643395 ATTCACTTTGTGAATAATTCTGG - Intergenic
1011509617 6:88086333-88086355 TTTCAAATGCTTAATAATTCTGG + Intergenic
1012267636 6:97165539-97165561 TCTCACATGATTATTAATGCTGG - Intronic
1012447407 6:99320961-99320983 AGTCAGATGGTGAATATTTCAGG + Intronic
1013087008 6:106865494-106865516 TCTCAAATGGCGAAAAAGTCAGG + Intergenic
1014923932 6:127248074-127248096 TCTCTCAAGATGAATCATTCTGG + Intergenic
1020347238 7:7179095-7179117 GCTCACATGGTGAGTAATTAAGG - Intronic
1023569684 7:41558956-41558978 TCTCGCATAGGAAATAATTCAGG + Intergenic
1023727459 7:43158864-43158886 TCTCTCTTGGTGCATAAGTCAGG - Intronic
1028015108 7:85699690-85699712 GCTCTCATGGTAAATAACTCTGG + Intergenic
1028044150 7:86094088-86094110 TCACCCATGGTGAATGCTTCTGG + Intergenic
1033684945 7:143630051-143630073 TCTCTCATGATGAAAAATTCCGG + Intronic
1033688118 7:143709270-143709292 TCTCTCATGATGAAAAATTCCGG + Intronic
1033699668 7:143827570-143827592 TCTCTCATGATGAAAAATTCCGG - Intergenic
1036189272 8:6655597-6655619 TCTCACATGGGAAAGAATTCAGG - Intergenic
1036687632 8:10922536-10922558 ACTCACATGATGATTGATTCTGG - Intronic
1037961508 8:23101920-23101942 TCTCACATGGTGGATAAAAGAGG - Intronic
1041009919 8:53531609-53531631 TGGCACTTGGTGATTAATTCAGG - Intergenic
1042141691 8:65685572-65685594 TCACACATGGTGATTAAATCTGG + Intronic
1042893279 8:73636469-73636491 TTTCATATGTTGAATAATTTTGG - Intronic
1046095469 8:109554283-109554305 TTTTATATGCTGAATAATTCTGG + Intronic
1046810696 8:118530076-118530098 TGTCACATGGTAACTAATTGTGG + Intronic
1047893864 8:129343684-129343706 TGTCATGCGGTGAATAATTCTGG + Intergenic
1048059639 8:130904822-130904844 TTTCACATGGTAAATTCTTCTGG + Intronic
1048599182 8:135900846-135900868 CCTCACATGGAGAATATTTGTGG - Intergenic
1049834123 8:144722553-144722575 TCTCTCATGCTGAATAAGGCTGG + Exonic
1051039334 9:12787721-12787743 TGTCCCATGGTGAATGATTATGG - Intronic
1060300453 9:122371719-122371741 TCTCCCCTGGTGAAGACTTCGGG + Intronic
1191950038 X:66580694-66580716 TCTCAGATGGGGAATGATTAGGG + Intergenic
1191996031 X:67095965-67095987 TCTCCCACAGTGAATTATTCAGG + Intergenic
1193258460 X:79377851-79377873 ACTCACAAGGTAAATATTTCAGG - Intergenic
1193479550 X:82010582-82010604 TCCCACATGAGCAATAATTCTGG + Intergenic
1193968563 X:88020901-88020923 TCTCACATGGGAAAGGATTCAGG + Intergenic
1195965826 X:110429282-110429304 TCTCACTTGTTGAATGACTCAGG + Intronic
1197781789 X:130167146-130167168 TTTCAGATGGTGAATACTTTCGG + Intergenic
1198547816 X:137711701-137711723 TCTGAGATGGAGAAAAATTCTGG + Intergenic