ID: 1091589720

View in Genome Browser
Species Human (GRCh38)
Location 12:1836054-1836076
Sequence CGTGCTGCCCAGAGGCTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091589710_1091589720 21 Left 1091589710 12:1836010-1836032 CCAGCTTATTGCAGACAGAGCCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG 0: 1
1: 0
2: 4
3: 31
4: 296
1091589717_1091589720 0 Left 1091589717 12:1836031-1836053 CCAGGAGCAGGAGCGGGTGGCCA 0: 1
1: 0
2: 1
3: 26
4: 296
Right 1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG 0: 1
1: 0
2: 4
3: 31
4: 296
1091589709_1091589720 25 Left 1091589709 12:1836006-1836028 CCTGCCAGCTTATTGCAGACAGA 0: 1
1: 0
2: 0
3: 18
4: 126
Right 1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG 0: 1
1: 0
2: 4
3: 31
4: 296
1091589716_1091589720 1 Left 1091589716 12:1836030-1836052 CCCAGGAGCAGGAGCGGGTGGCC 0: 1
1: 0
2: 1
3: 23
4: 296
Right 1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG 0: 1
1: 0
2: 4
3: 31
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091589720 Original CRISPR CGTGCTGCCCAGAGGCTCCC AGG Exonic
900117344 1:1034253-1034275 CCTGCTGCCCACAGCCTCCCCGG - Intronic
900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG + Intronic
900252519 1:1678520-1678542 AGTGCCACCCAGACGCTCCCAGG + Intronic
900515313 1:3079114-3079136 CCTGCTGCCCACCGCCTCCCTGG + Intronic
901149939 1:7094692-7094714 TGTGCTACACGGAGGCTCCCAGG + Intronic
902155134 1:14479001-14479023 CATGCTTCCCAGAAGCTCCCAGG - Intergenic
902282413 1:15384181-15384203 CTTGCAGACCACAGGCTCCCTGG + Intronic
902982694 1:20137352-20137374 GATGCTGCTCAGAGGCTCTCAGG + Intergenic
903809736 1:26028655-26028677 ACTGCTGCCCAGAGGTCCCCTGG - Intronic
904307408 1:29599082-29599104 CCTGCTGCCCAGGGGTGCCCGGG - Intergenic
904396333 1:30224865-30224887 CCTGCTGCCCAGGGGTGCCCGGG + Intergenic
904600474 1:31670045-31670067 AGGGCTGTCCAGAGGCACCCAGG - Intronic
904811140 1:33164169-33164191 GGTCCTGCCCAGAGGCACTCTGG + Intronic
905394926 1:37660938-37660960 AGAGCAGCCCAGAGGCTCCGAGG + Intergenic
906510660 1:46408844-46408866 ACAGCTGTCCAGAGGCTCCCAGG + Intronic
912245109 1:107953715-107953737 CATGCTGCCCCCATGCTCCCAGG + Intronic
912459160 1:109819667-109819689 GGACCTGCCCAGAGTCTCCCAGG + Intergenic
912947917 1:114099966-114099988 CCAGCTGCCCTGAGTCTCCCCGG - Intronic
913489810 1:119368406-119368428 TGTCCTGCCCATGGGCTCCCAGG + Intergenic
915595602 1:156894791-156894813 TGTGCTGGCCTGAGGTTCCCAGG + Intronic
916056925 1:161074347-161074369 CCTGCTTCCCAGAGTCTTCCTGG + Exonic
916090710 1:161306044-161306066 ACTGCTGCCCGGCGGCTCCCAGG + Intronic
916107500 1:161442070-161442092 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916109084 1:161449488-161449510 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916110672 1:161456869-161456891 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916112257 1:161464279-161464301 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916113844 1:161471660-161471682 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
919768816 1:201144225-201144247 CCTGATGCCGAGAGGCTCCCGGG + Intronic
920250063 1:204617550-204617572 CTCTCTGCCCAGAGGCTCCTGGG - Exonic
920704079 1:208239249-208239271 AGTTCAGCCCAGAGCCTCCCTGG + Intronic
921703180 1:218290371-218290393 TGTTCTGACCAGAGGCTCACAGG - Intronic
921755893 1:218855469-218855491 CTTGCTGTCCAGAGGCACCTTGG + Intergenic
922718686 1:227889487-227889509 CCTGCTGCACAGAGCCACCCAGG + Intergenic
923524374 1:234760679-234760701 CAGGTTGCTCAGAGGCTCCCCGG + Intergenic
923565762 1:235074758-235074780 AGTGCTGCTCAGACGCTCTCAGG - Intergenic
1062868414 10:877055-877077 CTTGCTGCCCAGAGCCGCCTCGG - Intronic
1063036764 10:2293948-2293970 GGTCCTGCCCAGAGTCACCCTGG + Intergenic
1063376580 10:5557948-5557970 GGTTCTGCCCAGAGACCCCCAGG - Intergenic
1065186128 10:23172661-23172683 GGCGCGGCCCCGAGGCTCCCCGG - Intergenic
1065811487 10:29447648-29447670 AGTTCTGCCCTGGGGCTCCCTGG + Intergenic
1065828694 10:29595350-29595372 CGTGCTGCTCTGAGGGTGCCGGG - Intronic
1067234834 10:44438916-44438938 CGGGGTGCCCAGAAGTTCCCAGG + Intergenic
1067285773 10:44906705-44906727 CATGCTCCCCAGAGCCACCCAGG + Intergenic
1067346981 10:45444052-45444074 CCTGCTGCCCAGCTGCCCCCTGG - Intronic
1069554008 10:69384857-69384879 CGTGAAGCCCAGAGGCATCCTGG - Exonic
1069878218 10:71576073-71576095 GGGGCTGCCCAGAGGCCCCCTGG - Intronic
1070777849 10:79120463-79120485 CAGGCTGTCCAGAGCCTCCCAGG - Intronic
1070922458 10:80196685-80196707 AGTGCTGCCCTGAGGCTGGCTGG - Intronic
1072610073 10:97011894-97011916 AGTGCTCTCCAGAGGCTTCCTGG - Intronic
1073427977 10:103467670-103467692 AGTGCTGCCCAGAGAGGCCCGGG + Intergenic
1074432676 10:113407146-113407168 CGTGCTGTGGAGAGGCCCCCTGG + Intergenic
1075401455 10:122164007-122164029 CGGGCCGCCCCGAGTCTCCCGGG + Intronic
1076584076 10:131533440-131533462 CGTGCTCCCCAGAGACTCTAGGG - Intergenic
1076686284 10:132199843-132199865 CCTGCTGCCCCGAGGCTGCTTGG - Intronic
1076741582 10:132488352-132488374 CCTGCTGCCCTGAGGCTCTGCGG + Intergenic
1076800123 10:132817882-132817904 CGCTCTGCCTGGAGGCTCCCGGG + Intronic
1076834669 10:133014989-133015011 CTTCCTGCCCAGAGGCAGCCCGG - Intergenic
1076889859 10:133278099-133278121 CAGGCTGCCGAGAGGCTCCCAGG + Intergenic
1076890041 10:133278958-133278980 CGGGCAGCCCTGAGGCTCCCAGG + Exonic
1077186118 11:1236159-1236181 CGTGCAGCCCCAAGGTTCCCAGG + Intronic
1077211352 11:1372211-1372233 CGTCCTTCCCTGACGCTCCCTGG - Intergenic
1077331936 11:1987669-1987691 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1078357521 11:10643334-10643356 CTGGCTCCCCAAAGGCTCCCCGG + Intronic
1080639325 11:34149652-34149674 CCTGCTACCCACAGGCTCCAAGG + Intergenic
1081695861 11:45108658-45108680 TGTGGTGCCCAGAGGCACCAGGG + Intronic
1083367041 11:62147642-62147664 CGTGCTGCCCGGTGTTTCCCAGG - Intronic
1083684937 11:64370254-64370276 CGCCCTGGCCAGAGGCCCCCTGG - Exonic
1084035364 11:66506596-66506618 CATGCTCTCCAGAGGCTTCCTGG + Intronic
1084530887 11:69727144-69727166 GGTGCTGCCCAGGAGCTCCCGGG + Intergenic
1085196132 11:74672923-74672945 TGTGCTGCCCAGAGAAACCCAGG + Intergenic
1085316932 11:75550960-75550982 CCTGCTCCCCAGAGCCTTCCCGG + Intergenic
1088747645 11:112817746-112817768 TGAGCAGCTCAGAGGCTCCCAGG - Intergenic
1089190393 11:116649237-116649259 TGTGCTGCCCTGTGGCTCCAAGG + Intergenic
1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG + Intronic
1089679138 11:120109807-120109829 CCTGCTGCACAGAGGCTGGCTGG - Intergenic
1090307226 11:125702066-125702088 AGACCTGCCCAGAGGCTGCCTGG + Intergenic
1090803226 11:130187600-130187622 AGTGCTGGCCACAGGCTCCTGGG + Intronic
1091296150 11:134475265-134475287 GGTGTTGCCCCGAGTCTCCCAGG - Intergenic
1202814917 11_KI270721v1_random:42845-42867 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1091918052 12:4283225-4283247 CGGGACCCCCAGAGGCTCCCAGG + Intronic
1093457920 12:19382734-19382756 TGTGATGCCCTGAGCCTCCCTGG - Intergenic
1095515708 12:43002998-43003020 CGTGCTGCACAAGGGCTCTCAGG - Intergenic
1096217575 12:49806741-49806763 CGTACAGCCCTAAGGCTCCCTGG + Intronic
1096727259 12:53574565-53574587 CGTGCTGCTCAGAGGTCTCCTGG + Intronic
1097087150 12:56477140-56477162 GTTGCTGCCCAGCTGCTCCCAGG + Exonic
1098039656 12:66341161-66341183 ATTGCTTCCCAGAGGCTCCTGGG - Exonic
1101275049 12:103190174-103190196 GGGGTTGCCCAGAGGCTCTCAGG - Intergenic
1101641381 12:106587520-106587542 CCTGCTTCCCAGAGGCTCCGAGG + Intronic
1101660337 12:106759690-106759712 CGTGCTGTCCATAGTCTCCTTGG + Intronic
1101837295 12:108304382-108304404 TCTGCTGCCCAGATGGTCCCCGG - Intronic
1101916736 12:108901782-108901804 CGTGATGCCCTAAGCCTCCCTGG - Intergenic
1102872251 12:116423135-116423157 CCTGATGACCAGAGGCACCCCGG - Intergenic
1103629741 12:122250374-122250396 CGTTGAGACCAGAGGCTCCCAGG - Intronic
1103700524 12:122846756-122846778 GGGGCGGCCCAGAGGCTGCCTGG + Intronic
1104038429 12:125114382-125114404 CGCGCTGCTCAGACGCTGCCAGG - Intronic
1104492189 12:129203776-129203798 TCTGCTGCCCATATGCTCCCTGG - Intronic
1104789416 12:131472515-131472537 GCTGATGACCAGAGGCTCCCCGG - Intergenic
1104924315 12:132306077-132306099 TGTGGTCCCCACAGGCTCCCAGG - Intronic
1105512374 13:21061376-21061398 CGTCCTGGCCGGCGGCTCCCGGG + Exonic
1105656887 13:22451462-22451484 CTTTGTGCCCTGAGGCTCCCTGG - Intergenic
1106076251 13:26463927-26463949 TGTGCTGCCAAGAGGCTTGCTGG - Intergenic
1107317894 13:39153252-39153274 CGTGCTGGTCAGATGCACCCTGG + Intergenic
1112220069 13:97479577-97479599 CGTCGTGCCCAGAGACTCTCTGG - Intergenic
1112311158 13:98318572-98318594 CAGGCTGCCCTGAGGCACCCTGG + Intronic
1113808350 13:113122876-113122898 CGTCCTGCTCAGTGCCTCCCTGG + Exonic
1113993199 14:16045219-16045241 CGGGCTCCCAAGAGTCTCCCTGG - Intergenic
1117140563 14:52786742-52786764 TGTGCTGCACAGAAGCCCCCTGG - Intronic
1118599507 14:67461994-67462016 GCTGGTGCCCAGAGCCTCCCTGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1119881223 14:78101429-78101451 CGTCCTGGCCAGATGCTTCCAGG - Intergenic
1120823905 14:88937858-88937880 CCTGCCGCCAAGATGCTCCCAGG - Intergenic
1121731365 14:96189402-96189424 CGGGCTGCCCAGAGCCTCCCAGG - Intergenic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1122263039 14:100534069-100534091 CCAGCTGCCTAGAGGGTCCCTGG + Intergenic
1122345683 14:101058344-101058366 TGTGCTGGCTAGAGGCTCCAAGG - Intergenic
1122582198 14:102777766-102777788 CGGGCAGCCCCGAGGCCCCCGGG - Intronic
1123631161 15:22260447-22260469 TGTGCTGCGCAGAGGGTCCTAGG + Intergenic
1126142368 15:45448780-45448802 CCTGCAGCCCAGACGCTCCCTGG - Intergenic
1129193494 15:73951280-73951302 CCTGCTGCCCACAGGCCCCCGGG - Intronic
1132333480 15:101028202-101028224 TGTGGTGACCAGAGGCTCGCAGG - Intronic
1132381973 15:101372311-101372333 CGTTCTGCTCAGAGCCTCTCAGG + Intronic
1132582037 16:689217-689239 CGTGCTGCTCAGTGGCTCCCAGG - Exonic
1132890197 16:2199950-2199972 TGTGCCGCCCAGAGGCCCCACGG + Intergenic
1133271707 16:4613738-4613760 TGTGCTGCCCAGAGGCTACCTGG - Intronic
1135256009 16:20942147-20942169 AGTGCTGCCCTGAAGCTACCTGG - Intronic
1135520603 16:23174522-23174544 CGTTGTGACCAGAGGCTCTCGGG + Intergenic
1137675424 16:50301617-50301639 GCTCCTGCCCAGTGGCTCCCAGG - Intronic
1140935014 16:79662325-79662347 CATGTTGTCCACAGGCTCCCTGG + Intergenic
1141275515 16:82584302-82584324 TGGGCTGCCAAGAGGCTCACAGG - Intergenic
1141627292 16:85268029-85268051 GGCACTGCCCAGAGGCTGCCAGG + Intergenic
1142308849 16:89300403-89300425 CTTCCTGGCCAGAGGCTCCCAGG + Intronic
1142397137 16:89838531-89838553 CGTGCTTCCCTGAGCTTCCCTGG - Intronic
1144680196 17:17188154-17188176 CGCGCTGTCCACAGCCTCCCGGG + Exonic
1145078447 17:19874569-19874591 CATGCTGCCCAGACCTTCCCTGG - Intergenic
1146061761 17:29611604-29611626 CGTGCTGCTCAGCGATTCCCAGG - Exonic
1146393679 17:32444761-32444783 GGAGCTCCCCAGAGCCTCCCAGG + Intronic
1146629007 17:34456815-34456837 CTTCCTGACCAGAGGCTCCTGGG - Intergenic
1148804808 17:50258820-50258842 GGAGCTGCTCAGGGGCTCCCGGG - Intergenic
1150220070 17:63491136-63491158 CGTGCTGCCGTGGGGATCCCGGG - Intronic
1151357620 17:73569935-73569957 CCTGCTGCAGAGAGGCTCCTCGG - Intronic
1151714298 17:75823621-75823643 AGTGCTGGGCAGAGGCTCTCAGG - Intronic
1151889625 17:76944455-76944477 TGTGGGGCTCAGAGGCTCCCAGG + Intronic
1152625283 17:81385322-81385344 CGTGTGGCCCTAAGGCTCCCAGG + Intergenic
1154173629 18:12067851-12067873 CGCGCTTCCCAGGGGGTCCCCGG - Intergenic
1156149012 18:34222429-34222451 CGGGCTGCCCCGTGCCTCCCGGG + Intronic
1157493182 18:48137933-48137955 CCAGCTGGCCAGAGCCTCCCAGG - Intronic
1157617730 18:48997097-48997119 CGTGGGCCGCAGAGGCTCCCAGG - Intergenic
1157748035 18:50153902-50153924 AGAGGTGCCCAGAGGCTCCAGGG - Intronic
1160858009 19:1226098-1226120 CGTGCTCCCCTGGGGCACCCTGG - Intronic
1160906741 19:1455267-1455289 CGCGCTGCCCCCTGGCTCCCCGG - Intronic
1161125843 19:2556682-2556704 CGGCTTTCCCAGAGGCTCCCGGG + Intronic
1161331360 19:3689259-3689281 CATCATGCCCAGAGGCTCACAGG + Intronic
1161592159 19:5133758-5133780 CTGGCTGCCCACAGGGTCCCTGG - Intronic
1161646322 19:5455597-5455619 CGTCCTGGCCACAGGCCCCCTGG + Exonic
1161971971 19:7587206-7587228 TTTGCTGCCCAGACTCTCCCTGG - Intergenic
1162625284 19:11880130-11880152 CGGGCTGCCCGGAAGCCCCCAGG - Intronic
1163235315 19:16026258-16026280 TGTGCTGCCCAGAGGCTTCGAGG + Intergenic
1163444386 19:17338214-17338236 TGCGCGGTCCAGAGGCTCCCCGG - Exonic
1165672635 19:37692438-37692460 CGGGCAGCCCTGAGCCTCCCAGG - Intronic
1166765984 19:45252167-45252189 GGGGCTGCCCACAGGCGCCCTGG - Intronic
1168474628 19:56666975-56666997 GGAGCTGCCCAGGGTCTCCCAGG + Intronic
925439802 2:3875592-3875614 AAAGCTGACCAGAGGCTCCCTGG - Intergenic
926048892 2:9730525-9730547 CCTACTGCCCTGGGGCTCCCAGG + Intergenic
926173938 2:10572306-10572328 AATGCTGCCCACAGGCTCCAGGG + Intronic
927638078 2:24830508-24830530 AGTCCATCCCAGAGGCTCCCTGG + Intronic
927648755 2:24898262-24898284 CGTGCGCCACAGAGGCCCCCGGG + Intronic
927849350 2:26489256-26489278 CCTGCTGCGCAGTGGCACCCTGG - Exonic
928183766 2:29090810-29090832 TGTGATGCCCAGAGGCACACAGG + Intergenic
931417084 2:62091572-62091594 AATGCTTCCCAGAGGCGCCCTGG + Intronic
932280681 2:70489260-70489282 AATGCTGCTCAGAGGCACCCTGG + Intronic
933704082 2:85277003-85277025 CATGCTGCCCTGCTGCTCCCCGG - Intronic
934655023 2:96112841-96112863 CTTGTTGCCCAAAGGCTGCCTGG - Intergenic
934718128 2:96554895-96554917 AGTGCTTCCCAGAGGCCCCAGGG - Intergenic
936235085 2:110735572-110735594 GGTGCTGGCCATCGGCTCCCAGG + Intronic
936268457 2:111029706-111029728 CCTGCTGGCAAGAGGCTCCCTGG - Intronic
936460261 2:112709146-112709168 TGTGCTGCCCAGAACCCCCCAGG + Intergenic
937953650 2:127407382-127407404 CCTGCTGGCCAGAGGCTTCCTGG - Intergenic
937968977 2:127535512-127535534 CATGCTGCCCGGAGGCCACCAGG - Intergenic
938538501 2:132265647-132265669 CGGGCTCCCAAGAGTCTCCCCGG + Intergenic
940290802 2:152075854-152075876 AGTGCTGCCCACAGTCTCCCTGG + Intronic
948352006 2:237348559-237348581 CTTGCTGCCAGGAGGCTCCAAGG - Intronic
948489420 2:238302944-238302966 TCTGATGCCCAGAGGCGCCCAGG + Intergenic
1169006033 20:2207711-2207733 CGCGATGCTCAGAGGCTCGCTGG + Intergenic
1169139895 20:3221849-3221871 CGTGGCACCCAGAGGCTGCCAGG + Exonic
1172039757 20:32035529-32035551 CGTGCAGCACTTAGGCTCCCTGG + Intergenic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1172296020 20:33811690-33811712 CGGGCTCCCCCCAGGCTCCCCGG + Intronic
1172442502 20:34976149-34976171 CCTGCCTCCCAGAGGCTCTCTGG + Intronic
1172442633 20:34976944-34976966 CCTGCCTCCCAGAGGCTCTCTGG - Intronic
1172806471 20:37615451-37615473 AGTGCTGCCCGGAGCCTCCTGGG - Intergenic
1173119882 20:40278991-40279013 CAAGCTGCCCAGATGATCCCAGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175820484 20:61906497-61906519 AGGGCTGCCAAGTGGCTCCCGGG + Intronic
1175912120 20:62410026-62410048 CGAGCTGCCCTGTGGCTGCCAGG + Intergenic
1176178631 20:63739770-63739792 CGCGCCGCCCGGAGGCTGCCCGG - Intronic
1176374529 21:6080531-6080553 CTTGCTGCCAGGAGGCTCCCCGG + Intergenic
1176553066 21:8238481-8238503 CGGGCTCCCAAGAGTCTCCCCGG - Intergenic
1176571988 21:8421505-8421527 CGGGCTCCCAAGAGTCTCCCCGG - Intergenic
1176579897 21:8466088-8466110 CGGGCTCCCAAGAGTCTCCCCGG - Intergenic
1176882738 21:14216539-14216561 AGGGCTTCCCAGAGGCTGCCTGG + Intronic
1179234015 21:39529184-39529206 TCTGCAGCCCAGAGGCCCCCAGG + Intergenic
1179376176 21:40851571-40851593 CAAGCAGCCCAGAGGCTCCCCGG - Intergenic
1179620749 21:42614097-42614119 GGGGCTGCCCTGAGGCTCCTGGG + Intergenic
1179748946 21:43457714-43457736 CTTGCTGCCAGGAGGCTCCCCGG - Intergenic
1180179437 21:46111465-46111487 GGTGCTGCCAAGATGCTCCAGGG + Exonic
1180198666 21:46212172-46212194 TGAGCTCCCCAGAGGCTCCCCGG - Intronic
1180314069 22:11262294-11262316 CGGGCTCCCAAGAGTCTCCCTGG + Intergenic
1180341287 22:11621240-11621262 CGGGCTCCCAAGAGTCTCCCGGG - Intergenic
1180625437 22:17190789-17190811 CGTTCTGCTCAGAGGCTCCCTGG - Intronic
1181049483 22:20231824-20231846 CGTGCTGGCCAGGGGCCCCAGGG + Intergenic
1181637880 22:24182643-24182665 CGTGCTGACCACAGACACCCTGG + Intronic
1181803288 22:25360750-25360772 CTCACTGCCCAGATGCTCCCGGG + Exonic
1182470751 22:30546794-30546816 CCTGTTGCCCTGAGGCTCACAGG - Intergenic
1182472123 22:30555112-30555134 CTTGGTGCCCAGCGGCTGCCAGG + Exonic
1183265760 22:36824167-36824189 AGTGCTGCCCAGAGGAACCCTGG + Intergenic
1184186792 22:42870090-42870112 CGGGCTGCCCGGAGTCGCCCGGG - Exonic
1184209148 22:43025042-43025064 CATGCCACCCAGAGGCTGCCAGG - Intergenic
1185392612 22:50570774-50570796 CTTGCTCCCCTGAAGCTCCCTGG - Intronic
1203258064 22_KI270733v1_random:155523-155545 CGGGCTCCCAAGAGTCTCCCCGG - Intergenic
950039622 3:9911529-9911551 AGTGCTGCCTGGAGCCTCCCAGG + Exonic
950199014 3:11029509-11029531 CCTGCCCTCCAGAGGCTCCCAGG + Intronic
950423774 3:12913874-12913896 CTGTCTGGCCAGAGGCTCCCAGG - Intronic
952903145 3:38122511-38122533 GGAGCTGCCCAGAGGTCCCCAGG - Exonic
952969163 3:38640008-38640030 TATGCAGCCCAGATGCTCCCAGG + Intronic
953848686 3:46449090-46449112 GGTCCTGCCCAGACTCTCCCTGG + Intronic
954626284 3:52023718-52023740 CCTGCTGGCCAGGGGCACCCTGG + Intergenic
954834982 3:53458434-53458456 CCTGCAACCCAGAGGCTCCCTGG - Intergenic
956430455 3:69181019-69181041 CCTTCTGCCCAGAGGCCCGCTGG + Exonic
961327511 3:126118090-126118112 CCTCCCGCCCACAGGCTCCCTGG - Exonic
961539063 3:127588282-127588304 TGTGTTTCCCACAGGCTCCCAGG + Intronic
961554356 3:127688099-127688121 CCTGCTTCCCAGAGGGTCCCTGG - Intergenic
963949393 3:151182492-151182514 CAGGCTGACCAGAGGCTCCCTGG - Intronic
966393484 3:179476977-179476999 CTTGCTGCCCAGAGCCACCTTGG - Intergenic
966878436 3:184336412-184336434 CGGGCTGCCCAGCCCCTCCCGGG - Intronic
967839811 3:193996260-193996282 CTTCCTGCCCAGAGTCACCCAGG + Intergenic
967921868 3:194619859-194619881 CGTCCTGCCCAGGGGCCCTCAGG + Intronic
968517238 4:1020582-1020604 CTTCCAGCCCAGAGGCACCCAGG + Intronic
969478575 4:7434877-7434899 CATGCTGCCCAGGGACTCTCTGG + Exonic
970223499 4:13834206-13834228 AGTGCTGCCTGGAGGCTCCTTGG - Intergenic
972599097 4:40555981-40556003 AGTGTTTCCCAGAGGCTCCTGGG - Intronic
973784166 4:54319510-54319532 CTTTCTGCCCAAAGGCTACCTGG - Intergenic
981727362 4:147861930-147861952 CTGGCAGCCCAGCGGCTCCCAGG + Intronic
985635286 5:1032911-1032933 CATCCTGCCCAGAGGCTGCGGGG + Intronic
985726716 5:1520042-1520064 CCTGCTGCCCACTGGGTCCCTGG - Intronic
987089988 5:14501870-14501892 TGTGCTTCCCAGGGGCTGCCTGG + Intronic
988166073 5:27590880-27590902 CCTAGTGCCCAGATGCTCCCAGG + Intergenic
990611167 5:57458258-57458280 GGTCCTGCCCAGAGGCTCTTTGG + Intergenic
990660582 5:58010124-58010146 CGTTGTGACAAGAGGCTCCCAGG + Intergenic
992220390 5:74566327-74566349 CGTGCTGCCCACAGGATCTCTGG + Intergenic
992961889 5:81964118-81964140 AAATCTGCCCAGAGGCTCCCAGG + Intergenic
994043704 5:95285006-95285028 GGTGCTGCCCAGAGGGCGCCGGG - Intergenic
995625175 5:114068647-114068669 AGTGCTTCCCAGAGGGTCCAGGG + Intergenic
997265393 5:132491859-132491881 CATGCTGCCCAGAACCTCTCTGG - Intergenic
997362236 5:133302506-133302528 AATGCCTCCCAGAGGCTCCCTGG - Intronic
997658474 5:135572702-135572724 TGTGGTGGCCAGAAGCTCCCTGG + Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1002200178 5:177523764-177523786 CATCCTGCCCAGTGGCTCCGTGG + Intronic
1003168651 6:3703078-3703100 CCTGCAGCCCAGGGGCTCCTTGG + Intergenic
1004320498 6:14628091-14628113 CATGCTGTCCAGATGCACCCAGG + Intergenic
1005898168 6:30195858-30195880 TGTGATCCCCAGAGGCTCCCGGG + Intronic
1006022810 6:31127320-31127342 CCTACTGCCCAGTGTCTCCCTGG + Intronic
1006063173 6:31441152-31441174 TGTGTGGCCCTGAGGCTCCCGGG + Intergenic
1006385341 6:33727630-33727652 TGTGGTGCTCAGAGGGTCCCTGG - Intronic
1006655734 6:35590768-35590790 CGTTCTGCCAAGTGGCTCCTTGG - Intronic
1007495058 6:42254230-42254252 CGTGCAGCTCAGAGGCTCTGAGG - Intronic
1008397431 6:51025252-51025274 TGTGCTGCGGAGAGGCTCCTTGG - Intergenic
1008894992 6:56542719-56542741 CGTGCTGCCCTGAGGAGCCGCGG - Intronic
1009355524 6:62739976-62739998 CCTGGTGCCCAGTGGCTCCTAGG + Intergenic
1009473312 6:64055976-64055998 TATGCTGCCCAGAGGCCCCTCGG + Intronic
1012625845 6:101402515-101402537 GGTGCTGCCCCGAGGCTCTATGG + Intronic
1017528027 6:155259802-155259824 GCTGCTGCCAAGAGGCTCTCAGG - Intronic
1018721085 6:166573055-166573077 CGGGGTGCCCAGAAGCTCTCGGG + Intronic
1019051938 6:169190277-169190299 GGTCCTGCCCAGTGTCTCCCGGG + Intergenic
1019311805 7:365819-365841 CGTGGTCCCCAGCCGCTCCCCGG - Intergenic
1019475311 7:1241499-1241521 GGTGGGGCCCAGCGGCTCCCTGG + Intergenic
1019562428 7:1665477-1665499 CAGGCCACCCAGAGGCTCCCAGG - Intergenic
1019652656 7:2168816-2168838 CGTGGGGCCCAGAGGCCACCGGG + Intronic
1020006129 7:4784575-4784597 CGGGGTGTCCAGAGGATCCCCGG - Intronic
1020009866 7:4801933-4801955 CGAGCTGCCCCCTGGCTCCCAGG - Exonic
1021969241 7:25950975-25950997 CGGGGCGCCCAGAGGCTCCCGGG + Intergenic
1023151495 7:37205169-37205191 ACTGCTGCCCAAAAGCTCCCTGG + Intronic
1023820106 7:43975864-43975886 TGTGCTGGGCAGGGGCTCCCTGG + Intergenic
1024259912 7:47566342-47566364 CGTGCTGCCCAAAGGTACTCAGG + Intronic
1024273488 7:47659534-47659556 CCTGGTGCACAGAGGCTCACTGG + Exonic
1027131847 7:75596825-75596847 CATGCTGCCGGGAGGCTCCCTGG - Intronic
1027994726 7:85411187-85411209 GGTGCTGCTCAGAGGTTCACAGG - Intergenic
1029527431 7:101103609-101103631 CAAGCTGGCCCGAGGCTCCCAGG + Intergenic
1029748384 7:102529317-102529339 TGTGCTGGGCAGGGGCTCCCTGG + Intergenic
1029766331 7:102628404-102628426 TGTGCTGGGCAGGGGCTCCCTGG + Intronic
1030989984 7:116288202-116288224 AGCTGTGCCCAGAGGCTCCCTGG + Intronic
1032079253 7:128850483-128850505 GGTACTGCCCTGTGGCTCCCAGG + Exonic
1034556614 7:151854444-151854466 CGTCCTGGCCAGAGGCTCTTGGG - Intronic
1034896973 7:154882344-154882366 CATTCTGCCCAGTGGATCCCGGG + Intronic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035062399 7:156079316-156079338 CAGGCTTCCCACAGGCTCCCTGG + Intergenic
1035081847 7:156222662-156222684 GGTGCTGCCTAGAAGCTACCTGG + Intergenic
1035451640 7:158980726-158980748 CGTGCTTCCTAGGGGCCCCCTGG + Intergenic
1036610117 8:10342508-10342530 CGTGCGGCTCAGAGGCCCCCGGG - Intronic
1038780052 8:30562415-30562437 CCTGCTCCCCACAGGCTCCGAGG - Intronic
1040838562 8:51759104-51759126 CCTGATGTACAGAGGCTCCCAGG + Intronic
1041727767 8:61033649-61033671 TGTTCTGCCCAAAAGCTCCCAGG - Intergenic
1042499008 8:69488882-69488904 TGCGGTGCCCTGAGGCTCCCCGG + Intronic
1045259421 8:100559415-100559437 CGCGCTGCCCAGGGGTTCCCCGG + Intronic
1047526657 8:125639732-125639754 TGTTCTGACCAGAGGCTCACAGG + Intergenic
1047955813 8:129974443-129974465 AGTGCTGCCTAGAGCATCCCAGG - Intronic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1049175264 8:141188829-141188851 CGTCAGGGCCAGAGGCTCCCAGG + Intronic
1049315635 8:141965670-141965692 CGTGAGGCCCAGAGGCTCAGTGG - Intergenic
1049539919 8:143203717-143203739 CCTCCTGGCCAGGGGCTCCCAGG + Intergenic
1049595124 8:143479937-143479959 CTTGCAGGCCAGAGGCTGCCCGG + Intronic
1049643214 8:143724863-143724885 AGTGCTGGCCAGAGCCTCGCTGG + Exonic
1049685467 8:143937581-143937603 CGTGCTGCCCAGAGCTGGCCTGG - Intronic
1056442744 9:86636888-86636910 GGTCCTGCTCTGAGGCTCCCTGG + Intergenic
1057190161 9:93082893-93082915 CATGATGCCGAGGGGCTCCCAGG + Intronic
1057954064 9:99393345-99393367 CGGGCTGCCCCATGGCTCCCAGG - Intergenic
1060401846 9:123354116-123354138 CCTGCTGTCCAGCGACTCCCTGG + Intergenic
1061289545 9:129642650-129642672 CGTCCTGGCCAGGTGCTCCCCGG - Intergenic
1061677719 9:132227829-132227851 CTTGCAGCCCAGGGGCTTCCTGG - Intronic
1061782668 9:133004972-133004994 CCTGCTGACAAGTGGCTCCCAGG - Intergenic
1061919416 9:133774543-133774565 CGTGCTGCTCTGAGGCAGCCAGG - Intronic
1062117837 9:134818706-134818728 CGGGCTTCCCAGGGGCCCCCTGG - Exonic
1062210942 9:135363689-135363711 CGTGCAGCCCACAGCCTGCCAGG + Intergenic
1062281413 9:135753590-135753612 TGTGCTGACAACAGGCTCCCAGG - Intronic
1062320635 9:135989090-135989112 CGGCCAGCCCTGAGGCTCCCAGG - Intergenic
1062685469 9:137810335-137810357 CGTCATCACCAGAGGCTCCCAGG - Intronic
1203474258 Un_GL000220v1:137546-137568 CGGGCTCCCAAGAGTCTCCCCGG - Intergenic
1186514173 X:10153933-10153955 AGTGCTGTCCAGAGGGTCCCAGG + Intergenic
1186660015 X:11660193-11660215 TGTGATGCCCAGGGGCTCCTTGG + Intronic
1189296647 X:39923188-39923210 CGTCCTGCACAGGGGCTGCCAGG + Intergenic
1195393810 X:104389908-104389930 CCTGCTGCCCAGAAGCCCTCTGG + Intergenic
1200162800 X:154018026-154018048 CTTCCTGCCCAACGGCTCCCTGG - Exonic