ID: 1091594704

View in Genome Browser
Species Human (GRCh38)
Location 12:1869415-1869437
Sequence TCCTCACCAGGTTAGGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091594704_1091594709 2 Left 1091594704 12:1869415-1869437 CCTGAGACCTAACCTGGTGAGGA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1091594709 12:1869440-1869462 CAGCTCCTCATGGAAGGCACTGG 0: 1
1: 0
2: 0
3: 25
4: 219
1091594704_1091594707 -8 Left 1091594704 12:1869415-1869437 CCTGAGACCTAACCTGGTGAGGA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1091594707 12:1869430-1869452 GGTGAGGATGCAGCTCCTCATGG 0: 1
1: 0
2: 2
3: 24
4: 228
1091594704_1091594712 15 Left 1091594704 12:1869415-1869437 CCTGAGACCTAACCTGGTGAGGA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1091594712 12:1869453-1869475 AAGGCACTGGCTCCGTCTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1091594704_1091594708 -4 Left 1091594704 12:1869415-1869437 CCTGAGACCTAACCTGGTGAGGA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1091594708 12:1869434-1869456 AGGATGCAGCTCCTCATGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 174
1091594704_1091594711 14 Left 1091594704 12:1869415-1869437 CCTGAGACCTAACCTGGTGAGGA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1091594711 12:1869452-1869474 GAAGGCACTGGCTCCGTCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091594704 Original CRISPR TCCTCACCAGGTTAGGTCTC AGG (reversed) Intronic
904583382 1:31564488-31564510 CCCTCTCCAGGCTAGGTTTCTGG + Intergenic
905624137 1:39475850-39475872 TCATCACCAGGTCAAGTCTAAGG + Intronic
905671216 1:39791476-39791498 TCATCACCAGGTCAAGTCTAAGG - Intergenic
906792605 1:48671941-48671963 TCCTCACCAGGTTTAGTTTCAGG + Intronic
907446796 1:54513341-54513363 TCGTCACCACGTTGGGGCTCTGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915060081 1:153174414-153174436 TCCTCACCAGGCTAGTTTTGTGG - Intergenic
916786598 1:168091249-168091271 TCTTCTCCAGGCTAGGCCTCGGG + Intronic
917197704 1:172483835-172483857 TCCTCAGCATATTAGGTCCCTGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920652037 1:207845137-207845159 TCCGTACCAGGATAAGTCTCCGG + Intergenic
920767991 1:208851998-208852020 TTTTCACCAGGTTTGGTCCCTGG + Intergenic
921598241 1:217078543-217078565 TCCCCACCAGGTTTCATCTCAGG + Intronic
923889131 1:238191756-238191778 TCACCAGCAGGTTAGGTATCTGG - Intergenic
1068703109 10:60041382-60041404 TCCGACCCAGGTTAAGTCTCTGG + Intronic
1069712946 10:70501358-70501380 GCCAGACCAGGTTAGTTCTCAGG - Intronic
1070626332 10:78053864-78053886 TCCTCCCAAGCTTAGGGCTCAGG - Intronic
1072979138 10:100085186-100085208 TACTCACCATGTTAGGTGTTGGG + Intergenic
1075609082 10:123836882-123836904 TTCCCCCCAGGTGAGGTCTCAGG + Intronic
1078113034 11:8415264-8415286 CCCTCTCCAGGTTAAGTCTTTGG + Intronic
1083189906 11:61042358-61042380 TCCTCCCCAGGCGTGGTCTCCGG - Intergenic
1086181142 11:83953260-83953282 TCCTCAACTGGTCAGGTCTATGG + Intronic
1091594704 12:1869415-1869437 TCCTCACCAGGTTAGGTCTCAGG - Intronic
1093349477 12:18080230-18080252 TGCTGACAAAGTTAGGTCTCAGG - Intergenic
1101919139 12:108918615-108918637 TCCTCACTAGGTGTGGTCTGGGG + Intronic
1102880802 12:116482996-116483018 TCCACCCCAGGTTAGGCCACTGG + Intergenic
1103945426 12:124523439-124523461 TCCTTCCCGGGTTAGGTCCCTGG - Intronic
1104913440 12:132251578-132251600 TTCTGACCAGGAGAGGTCTCAGG + Intronic
1105986306 13:25570863-25570885 TCTTCCCCAGGTGAGGGCTCTGG + Exonic
1108601418 13:51998346-51998368 TCATCACCATGTTAGGTCTGTGG - Intronic
1115646151 14:35369650-35369672 TCCTCCCCAGGTGGGGCCTCCGG + Intergenic
1122877772 14:104676814-104676836 CCCTCACTAGGTCGGGTCTCTGG + Intergenic
1122891033 14:104732375-104732397 CCATCACCAGTTGAGGTCTCAGG - Intronic
1129684360 15:77676838-77676860 TCCTCACCAGGCTTTGTCCCCGG - Intronic
1137758349 16:50920224-50920246 CCCTCACTGTGTTAGGTCTCGGG - Intergenic
1141119193 16:81337935-81337957 GACTCACTAGGGTAGGTCTCAGG + Intronic
1144628815 17:16859230-16859252 CCCTCACCAGGTTGAGTCTGAGG - Intergenic
1145160387 17:20569803-20569825 CCCTCACCAGGTTGAGTCTGAGG - Intergenic
1147767847 17:42849035-42849057 TCCACACCAGGTAAGGTCTCTGG - Intronic
1150433383 17:65136726-65136748 TCCTCACCGGGCTAGCTGTCTGG - Intergenic
1151289093 17:73135957-73135979 TCCTCACTGGGTTAGTTCTATGG - Intergenic
1153462665 18:5353712-5353734 TCCTCACACTGTTGGGTCTCTGG - Intergenic
1153994068 18:10424375-10424397 TCCTCACCAGGGCAGGTTTTAGG - Intergenic
1157130683 18:45004600-45004622 TGGGCACCAGGTTAGATCTCAGG - Intronic
1160223282 18:76992592-76992614 GCCTCACCACGTTAGGGCCCAGG - Intronic
1160534006 18:79581498-79581520 TCCACACCAGCCTGGGTCTCAGG - Intergenic
1164403362 19:27919038-27919060 TCCTCCCCAGGTGAGGGCTGTGG + Intergenic
1165240243 19:34460820-34460842 TCATCACAAGGTTAGCTCCCAGG - Intronic
1166266221 19:41686269-41686291 TCCTCTCCAGGCTGAGTCTCAGG + Intronic
925973180 2:9122038-9122060 TGCTCTCCAGGGGAGGTCTCTGG + Intergenic
926774565 2:16409097-16409119 TGCTCACCAGCCTAGGGCTCAGG + Intergenic
929075089 2:38074333-38074355 TCTTCACCAGGTAAAGCCTCTGG - Exonic
933789414 2:85872102-85872124 CCCTCACCAGGGTAGGCCTCGGG - Intronic
937882413 2:126878286-126878308 TCCTCTCCAGGCCAGGTCTGGGG + Intergenic
940065003 2:149617554-149617576 TCCCCAGCAGGTCTGGTCTCAGG - Intergenic
943082899 2:183277886-183277908 TCCTCTCCAAGTAAGGTCACTGG - Intergenic
948436988 2:237960617-237960639 TCCTCTCCAGGTTAGACCCCAGG + Intergenic
948557412 2:238822827-238822849 GCCTCACCAGGTCAGGACTCTGG - Intergenic
948994014 2:241569706-241569728 GCCTCAGCAGGTTAGGGGTCTGG + Intronic
1173809989 20:45949728-45949750 TCCTCCCCAAGGTAGGTCTTTGG + Intronic
1175157003 20:56977869-56977891 ACCTCACCAGGATGGGTCGCTGG - Intergenic
1176302367 21:5104702-5104724 TCCTAACCAGGTCAGGTATGCGG + Intergenic
1179854660 21:44157221-44157243 TCCTAACCAGGTCAGGTATGCGG - Intergenic
1180741855 22:18059020-18059042 TCCTCACCAGGCTGGATCTGGGG - Intergenic
1183035508 22:35138229-35138251 TCTTCCCCAGGATAGGTCTGGGG + Intergenic
1185166891 22:49266898-49266920 TCCGCACCAGGTCAGGACTCAGG - Intergenic
1185203207 22:49521206-49521228 TCCTCACAAGGCTGGGTCTGTGG - Intronic
949473083 3:4417150-4417172 TCCTCACCAGTGTTGGTCACCGG + Exonic
952628828 3:35440268-35440290 GCTTCACCAGGTTAGTTATCTGG + Intergenic
955543481 3:60002540-60002562 TCCTCACCATGTTTGGCCTGAGG + Intronic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
959354616 3:105309940-105309962 TCTCCACCAGGTTTGGTATCAGG - Intergenic
960180309 3:114567957-114567979 TCCACACCAGCTTTGGGCTCAGG + Intronic
962363512 3:134761322-134761344 TCCACACCAGGTTCTCTCTCAGG - Intronic
963385035 3:144581774-144581796 TCTTCACCAGGTGAGGACGCAGG + Intergenic
966238923 3:177733347-177733369 TCCTAAACAGGATTGGTCTCAGG - Intergenic
968229303 3:196995955-196995977 TCCACACCAGGATAGGGCTGTGG + Intronic
968501797 4:953546-953568 TCCTCGACAGGCTGGGTCTCGGG - Intronic
971051394 4:22866623-22866645 TCCTCAACTGGTTTGGTCTTAGG - Intergenic
977680119 4:99789606-99789628 GCCTCTCCAGGATTGGTCTCTGG + Intergenic
982472512 4:155810524-155810546 TCCTCACCAGAATTGGACTCAGG - Intergenic
985807018 5:2053245-2053267 CCCTCACCAGGTGTGGTCCCAGG - Intergenic
986585905 5:9318233-9318255 TCCTCAGCAGGTCAGGCCACGGG - Intronic
991214605 5:64148157-64148179 TCCTAACCAGCTCAGTTCTCTGG - Intergenic
992176261 5:74151733-74151755 TGCCCACCAGGTTGGATCTCAGG - Intergenic
992933619 5:81677690-81677712 TCCTAACCAGGTCTGCTCTCAGG + Intronic
998456418 5:142277262-142277284 TCCTCACCAGGTGGGGACTGGGG + Intergenic
998678482 5:144437105-144437127 TCCTCAACAGGCTAGGCCACAGG + Intronic
999459448 5:151745325-151745347 TACTCACCAGGGTGGGACTCTGG + Intronic
1001286190 5:170425741-170425763 ACCTCTCCAGGTGAGGGCTCTGG + Intronic
1004333544 6:14743131-14743153 TCCTCACCAGAAAAGGTCTCAGG - Intergenic
1010880668 6:81166144-81166166 TCCTCATTAGGTGAGTTCTCAGG - Intergenic
1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG + Intergenic
1017963884 6:159246891-159246913 TCCTCACTAGATGAGTTCTCAGG + Exonic
1024930758 7:54664870-54664892 TCATATCCAGGTTAGGTCACGGG + Intergenic
1026633064 7:72054983-72055005 TCCTCATCAGGTTAGACCTCAGG - Intronic
1028596403 7:92550460-92550482 TCATCACCAGGATGGGTCTTTGG - Intergenic
1030340900 7:108379051-108379073 TCCTCCCTAAGATAGGTCTCAGG + Intronic
1035422667 7:158742350-158742372 TCCTCCCCAGGCCACGTCTCAGG + Intronic
1035929453 8:3764522-3764544 TCCCCACCTGGTGATGTCTCAGG - Intronic
1036296687 8:7543315-7543337 TCCTCACCAGCCTGGGCCTCTGG + Intergenic
1036325880 8:7777704-7777726 TCCTCACCAGCCTGGGCCTCTGG - Intergenic
1036752811 8:11454106-11454128 TCCTCAGCAGGGCAGGTCTTGGG + Intronic
1037030901 8:14103527-14103549 ACCTCAAATGGTTAGGTCTCTGG + Intronic
1041545593 8:59038973-59038995 TCCACACCAGCTTTGGCCTCAGG + Intronic
1044546382 8:93465034-93465056 CCCTCTCCAGGTTTGTTCTCAGG - Intergenic
1045460038 8:102417421-102417443 TCCTCAGTAGGTTAATTCTCAGG - Intergenic
1053395570 9:37770864-37770886 TCCCCACCAGGTTGGCCCTCTGG + Intronic
1056106591 9:83353215-83353237 TTCTCATCAGTTCAGGTCTCTGG - Intronic
1059362734 9:113758332-113758354 TCCACATCAGGGGAGGTCTCAGG + Intergenic
1060280968 9:122215467-122215489 TCCTCAGCATGTTAAGTCTGTGG + Intronic
1185931733 X:4211222-4211244 TCATCTCCAGGTTAGGTCAAAGG + Intergenic
1187829313 X:23364805-23364827 ATCTCAACAGGTAAGGTCTCAGG - Intronic
1194593629 X:95832269-95832291 TCTCCACCAGGTTTGGTATCAGG + Intergenic
1195822688 X:108964277-108964299 TACTCCCCAGTTTAGGCCTCAGG - Intergenic
1195856572 X:109338605-109338627 TCCTCACCAGGCTGGGACACTGG - Intergenic
1198631948 X:138649500-138649522 TCCTGCCCAAGTTATGTCTCTGG + Intronic
1201159844 Y:11158253-11158275 TCCCAACCAGGGAAGGTCTCTGG + Intergenic
1202344583 Y:23908061-23908083 TCCTGAGCATGTTATGTCTCTGG - Intergenic
1202526185 Y:25762022-25762044 TCCTGAGCATGTTATGTCTCTGG + Intergenic