ID: 1091596408

View in Genome Browser
Species Human (GRCh38)
Location 12:1881839-1881861
Sequence ATAAGCCATCTGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091596408_1091596413 24 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596413 12:1881886-1881908 AGTAAGCATGCCACTGCTTTTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1091596408_1091596412 -1 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596412 12:1881861-1881883 TGTCTACTATTAACAGGTGGAGG 0: 1
1: 0
2: 2
3: 5
4: 99
1091596408_1091596410 -7 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596410 12:1881855-1881877 GGCTTATGTCTACTATTAACAGG 0: 1
1: 0
2: 1
3: 5
4: 73
1091596408_1091596411 -4 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596411 12:1881858-1881880 TTATGTCTACTATTAACAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091596408 Original CRISPR ATAAGCCATCTGGCCAAATT TGG (reversed) Intronic
902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG + Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
906573468 1:46865221-46865243 ACAGGCCATCTAGACAAATTTGG + Intergenic
919086045 1:192921075-192921097 ATAAGCAATTTGTCCAAACTAGG + Intergenic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
921817369 1:219579124-219579146 ATAGTCCATCAGACCAAATTAGG + Intergenic
923249962 1:232170768-232170790 GAGAGCCATCTGGCCAAAGTGGG - Intergenic
924363048 1:243261092-243261114 ATGAGGCTTATGGCCAAATTGGG + Intronic
1067781841 10:49213383-49213405 GTGAGCCATCTGCCCAAAGTTGG + Intergenic
1068458036 10:57285563-57285585 ATAAGCCACATGGCCAATTTTGG - Intergenic
1071688496 10:87789310-87789332 ATAAGCTATCTCGTGAAATTTGG + Intronic
1071815181 10:89225117-89225139 ACTAGCCCTATGGCCAAATTAGG - Exonic
1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG + Intergenic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1074538456 10:114345607-114345629 ATCAGGGATGTGGCCAAATTGGG - Intronic
1074841655 10:117358830-117358852 ATAAGGCATCTGGCCCAGTGAGG + Intronic
1074957622 10:118407799-118407821 ATAAGCCAATTGGCCCATTTAGG + Intergenic
1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG + Intergenic
1082196671 11:49315086-49315108 AAAAGGCATCTGGCTACATTTGG - Intergenic
1086279215 11:85166431-85166453 AAAAGCCAGGTAGCCAAATTGGG - Intronic
1086659155 11:89393119-89393141 AAAAGGCATCTGGCTACATTTGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1094186268 12:27646264-27646286 ATAAGCCATCTGTACACAATAGG + Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG + Intronic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1099078177 12:78138815-78138837 AAAAGCCATCTTGCCCACTTAGG - Intronic
1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG + Intronic
1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG + Intergenic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1120363592 14:83537813-83537835 TTAAGACATATGGCCAAATTGGG + Intergenic
1121432453 14:93897717-93897739 TTTAGCCATCAGGCCACATTAGG - Intergenic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1128777198 15:70329513-70329535 ATAAGTTGTCTGGCCAACTTGGG - Intergenic
1144511481 17:15880876-15880898 GTAAGCAATCTTGCCCAATTAGG - Intergenic
1145122976 17:20277326-20277348 GTAAGCCATCTTACCCAATTAGG - Intronic
1146943328 17:36858753-36858775 TGAAGCCAGCTGGCCAAGTTTGG + Intergenic
1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG + Intronic
1149862801 17:60133217-60133239 ATAAGCAATATGGCAAAGTTGGG - Intergenic
1159839506 18:73381956-73381978 ATAAGTTATATGGCAAAATTGGG + Intergenic
1163270483 19:16250329-16250351 ATAAGGCCCCTGGCCAAACTGGG + Intergenic
1164487846 19:28676417-28676439 ATAGTCCTTCTGGTCAAATTTGG + Intergenic
1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG + Intergenic
928631870 2:33201815-33201837 ATAAGCCTTAGGGCAAAATTGGG + Intronic
928849300 2:35723856-35723878 ATAAGAAATCTGGCCAGATGAGG - Intergenic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
942138598 2:172954919-172954941 ATAAGGTACCTGGCCAAAATGGG - Intronic
944390915 2:199218553-199218575 TTAAGACATCAGGCCAAATCTGG + Intergenic
945675772 2:212853864-212853886 ATAATTCATTTGGCCAAGTTAGG - Intergenic
945835310 2:214832831-214832853 AAATGCCACCTGGCCAAATTTGG - Intergenic
947380476 2:229540522-229540544 ATAGCCCATGTGGCCAAGTTGGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1170111437 20:12808346-12808368 AGAAGCCAACTGGCCAAAATTGG + Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1172467389 20:35166365-35166387 TTAAGCAACCTGGCCCAATTTGG - Intergenic
1173129071 20:40370674-40370696 AAAAACCATTTGGCCAAACTAGG + Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1180114406 21:45689242-45689264 ATAAGCCATCAGGACCAAATGGG + Intronic
1181594984 22:23908294-23908316 ATGACCCATGTGGCCAAAGTGGG - Intergenic
1182291386 22:29282672-29282694 ATAAGTCATCTGACCATACTTGG + Intronic
1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG + Intronic
950204093 3:11064696-11064718 ATAAGCCATCATGACAAATGAGG - Intergenic
951545388 3:23819642-23819664 TTAAACCATCCGACCAAATTAGG - Intronic
951931759 3:27975284-27975306 ATATGCCAGCTGGCCACAATAGG + Intergenic
955653915 3:61223660-61223682 ATACACCATCTGGCAAAATGTGG - Intronic
957023472 3:75151596-75151618 CTCAGGCATCTAGCCAAATTTGG + Intergenic
961335140 3:126171482-126171504 AGGAGCCTTCTGGCCAAGTTAGG - Intronic
964576087 3:158170148-158170170 ATAAGCCAGGTGAACAAATTAGG - Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966039731 3:175467303-175467325 ATAAGCCATCTCAGCAAATTAGG - Intronic
970291849 4:14581647-14581669 AACAGCCATTTGGACAAATTTGG - Intergenic
970477593 4:16439417-16439439 ATAAGCCATTTTCCCAACTTGGG - Intergenic
974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG + Intergenic
975355339 4:73396069-73396091 ATAAGCCAAATGGGTAAATTTGG + Intergenic
978387814 4:108193187-108193209 AACAGCAATCTGACCAAATTTGG - Intergenic
984381084 4:178994298-178994320 GTATGCCATCTTGCCATATTTGG + Intergenic
994248591 5:97510344-97510366 ATATGCCATGGGGCCATATTTGG - Intergenic
994746246 5:103681946-103681968 TTAGGCCATCTGCCCAACTTGGG - Intergenic
998091799 5:139375374-139375396 ATATACCATCTGGCTAAATCTGG - Intronic
999206611 5:149852947-149852969 AAAATCCAACTGCCCAAATTTGG + Exonic
999259495 5:150229260-150229282 TTAAGCCATCTGGAGAATTTGGG - Intronic
999885130 5:155914078-155914100 ATAAGCAACTTGCCCAAATTTGG + Intronic
1000913375 5:167049700-167049722 ATAAGCAACCTTGCTAAATTAGG - Intergenic
1001880288 5:175237723-175237745 ATAAGCCTTCTGCCCATTTTAGG - Intergenic
1003059526 6:2851930-2851952 ATCAGCCAACTGGGCAAATGTGG - Intergenic
1003692670 6:8370096-8370118 ACAAGCCAGCTGACCAAAATAGG + Intergenic
1004928470 6:20438724-20438746 ATAACCAATCTGGGCAATTTGGG + Intronic
1006763904 6:36487926-36487948 ATAACCCAACTGGCCTGATTTGG - Exonic
1007068693 6:39018833-39018855 AAAATCCATCTGGCCATTTTTGG - Intronic
1007943247 6:45801815-45801837 AGAAAGCTTCTGGCCAAATTTGG + Intergenic
1010050599 6:71499423-71499445 ATAAGTCATCTGGCCTTATTTGG + Intergenic
1011167121 6:84461373-84461395 ATAAGCCATCTGGCCTCTTTAGG - Intergenic
1013458418 6:110353504-110353526 AAAAACCATATGGCAAAATTTGG - Intronic
1014041609 6:116833611-116833633 ATAAGCCAGCTGGGCAAGTACGG - Intergenic
1015615574 6:135071020-135071042 ATAAGCAATATGTTCAAATTTGG + Intronic
1015708766 6:136116786-136116808 ATGAGCCATCTGGCCAGAACAGG + Intronic
1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG + Intronic
1021242380 7:18219511-18219533 GTAAGCCATCTGCCAAAATTTGG + Intronic
1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1038200980 8:25412494-25412516 ATAACCCAGCTTGCTAAATTAGG + Exonic
1042741241 8:72049561-72049583 ATAAGCAATCTGGGAAAGTTGGG - Intronic
1043104470 8:76090288-76090310 ATAAGGCATCTGGTGGAATTTGG - Intergenic
1043476790 8:80613121-80613143 ATATGGGATGTGGCCAAATTTGG - Intergenic
1046872095 8:119215076-119215098 ATAGGTCATGTGGGCAAATTTGG + Intronic
1046963075 8:120130336-120130358 ATGACCTATCTGGCCAAATGTGG - Intronic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1052678953 9:31663502-31663524 ATAAATGAGCTGGCCAAATTTGG + Intergenic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1052833966 9:33236550-33236572 AGAAGCCATGTGGGCAAAGTGGG - Intronic
1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG + Intergenic
1189516344 X:41716743-41716765 TTATCCCATCTGGCAAAATTGGG + Intronic
1193722798 X:85006248-85006270 GTAAATCATCTGGCCAAAGTGGG - Intronic
1194736449 X:97517814-97517836 ATCAGCCATATGTCCAACTTTGG - Intronic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic