ID: 1091596410

View in Genome Browser
Species Human (GRCh38)
Location 12:1881855-1881877
Sequence GGCTTATGTCTACTATTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091596408_1091596410 -7 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596410 12:1881855-1881877 GGCTTATGTCTACTATTAACAGG 0: 1
1: 0
2: 1
3: 5
4: 73
1091596402_1091596410 25 Left 1091596402 12:1881807-1881829 CCCCTTTAAAGTAGATTAATGAG 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1091596410 12:1881855-1881877 GGCTTATGTCTACTATTAACAGG 0: 1
1: 0
2: 1
3: 5
4: 73
1091596407_1091596410 -6 Left 1091596407 12:1881838-1881860 CCCAAATTTGGCCAGATGGCTTA 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1091596410 12:1881855-1881877 GGCTTATGTCTACTATTAACAGG 0: 1
1: 0
2: 1
3: 5
4: 73
1091596403_1091596410 24 Left 1091596403 12:1881808-1881830 CCCTTTAAAGTAGATTAATGAGC 0: 1
1: 0
2: 3
3: 18
4: 184
Right 1091596410 12:1881855-1881877 GGCTTATGTCTACTATTAACAGG 0: 1
1: 0
2: 1
3: 5
4: 73
1091596404_1091596410 23 Left 1091596404 12:1881809-1881831 CCTTTAAAGTAGATTAATGAGCT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1091596410 12:1881855-1881877 GGCTTATGTCTACTATTAACAGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091596410 Original CRISPR GGCTTATGTCTACTATTAAC AGG Intronic
903581333 1:24373072-24373094 GGCTTGTGTCTGCCATTTACTGG + Intronic
912053743 1:105568255-105568277 GTCTTTTTTATACTATTAACTGG + Intergenic
917043118 1:170828341-170828363 GGCTTATCTCTACCACTAAGGGG + Intergenic
917202981 1:172536852-172536874 TCCTTATGTCTACTAATGACTGG + Intronic
918202478 1:182280094-182280116 AGCTTATGTCCTCTATAAACAGG - Intergenic
918773525 1:188596498-188596520 GGCTTATGTATATGATTAAAAGG + Intergenic
920175283 1:204097357-204097379 TGCTGATGTGTACTATTAAGTGG + Intronic
920229134 1:204458973-204458995 CGTTTATGACTACTATTAACTGG + Intronic
921983830 1:221286764-221286786 GGTTTGTGTTTCCTATTAACTGG + Intergenic
922331446 1:224580390-224580412 GGCTTATGTCTCCTTTTCCCAGG - Intronic
1066823099 10:39521398-39521420 TGCTTATGTCTAGTTTTTACAGG - Intergenic
1066823167 10:39522834-39522856 GGCTTATGTCTAGTTTTTATGGG - Intergenic
1067255866 10:44640435-44640457 GGCTTATTTTTACATTTAACTGG - Intergenic
1069027808 10:63562631-63562653 GGCTTATGTCAACAAGTCACAGG - Intronic
1071264166 10:83949332-83949354 GGCATATGTGTACTATTAACAGG + Intergenic
1071312891 10:84360451-84360473 GGCTTATTTTTACTATTTATAGG + Intronic
1075848580 10:125567504-125567526 GGCTTATGTATCATCTTAACAGG - Intergenic
1079987377 11:27213203-27213225 AGATTATGTCTTGTATTAACAGG - Intergenic
1091128318 11:133122119-133122141 GTGTTATCTCTACTATTACCAGG - Intronic
1091596410 12:1881855-1881877 GGCTTATGTCTACTATTAACAGG + Intronic
1092867031 12:12771298-12771320 GGCTTTTATCTACCATTAGCAGG + Intronic
1093495371 12:19751098-19751120 GGCCTATATACACTATTAACAGG + Intergenic
1094229586 12:28087511-28087533 GGCTTATGTTTATAATTAATGGG - Intergenic
1096442310 12:51654021-51654043 GTCTTTTGTCTATTTTTAACTGG + Intronic
1103330106 12:120148346-120148368 GGCTTGTGTCTGCTATCCACAGG - Exonic
1106150115 13:27091938-27091960 GGGTTAGGTCTACTATTCTCTGG + Intronic
1113573488 13:111376995-111377017 TCCTTATGTCTACTATTAATAGG + Intergenic
1120804024 14:88725764-88725786 GGCTTCTGTCATCTACTAACTGG - Intronic
1121771176 14:96541601-96541623 GGCTTTTGTCTAATATGAATGGG + Intronic
1133722054 16:8503743-8503765 GTCTTTTTTATACTATTAACTGG + Intergenic
1136749260 16:32618185-32618207 TGCTTATTTCTGCTATAAACTGG - Intergenic
1137098130 16:36336883-36336905 TGCTTCTGTCTACTATTTATGGG + Intergenic
1139348573 16:66321000-66321022 AGCTTAGGTCTGCTGTTAACTGG - Intergenic
1203051394 16_KI270728v1_random:877399-877421 TGCTTATTTCTGCTATAAACTGG - Intergenic
1146698650 17:34933079-34933101 GCCTTATGACTACTTTTAAGAGG + Intronic
1147180584 17:38682576-38682598 GGGTTATGTTTACTTTTAAAGGG - Intergenic
1153779359 18:8480303-8480325 GGTTGGTGTCTGCTATTAACAGG - Intergenic
1154428650 18:14291562-14291584 GGCTTTTGGGTACTATCAACCGG + Intergenic
1155656638 18:28200847-28200869 GGATTCTTTCTACTATTGACTGG - Intergenic
1156221938 18:35061590-35061612 AGCTTATGTGTGCTATTACCTGG + Intronic
1162446422 19:10725722-10725744 GGCTTTTGTCTCCTTTTATCTGG + Intronic
1165610653 19:37149485-37149507 GACTGATGACTAATATTAACAGG + Exonic
928284887 2:29981390-29981412 GTCCTATGTCTGCTACTAACTGG + Intergenic
939331014 2:140761136-140761158 AGCTACAGTCTACTATTAACTGG + Intronic
939692982 2:145288946-145288968 AGCTTATGTCTACCATCAAATGG + Intergenic
945595759 2:211789535-211789557 GGATTATGTCTGCATTTAACTGG + Intronic
945693197 2:213068300-213068322 GTTTTATTTCTTCTATTAACTGG + Intronic
946528784 2:220548865-220548887 GCCTTAAGTCTTCTATTATCTGG + Intergenic
1171579024 20:26376703-26376725 TGCTTCTGTCTAATATTTACAGG - Intergenic
1171591603 20:26610505-26610527 TGCTTATGTCTAGTTTTTACGGG - Intergenic
1171674792 20:27858191-27858213 TGCTTATGTCTAGTTTTTACGGG - Intergenic
1171687099 20:28042653-28042675 TGCTTATGTCTAGTTTTTACGGG - Intergenic
1176846118 21:13877861-13877883 GGGTTTTGTGTACTATCAACCGG - Intergenic
1184620788 22:45674606-45674628 GGCTGTTGTCTAGTATGAACAGG + Intronic
951740462 3:25916593-25916615 GGCTTATGTCTATAATAAACTGG - Intergenic
953129161 3:40121335-40121357 GGCTGGGGTCTAGTATTAACAGG - Intronic
953708526 3:45249530-45249552 GGCTGATGTCCAATATTAGCTGG + Intergenic
956194766 3:66642088-66642110 GGCTTATATTTACTTTCAACAGG + Intergenic
970351937 4:15210011-15210033 GGCCGATGTATACTATTAAGAGG - Intergenic
974706043 4:65517485-65517507 GGCTTAATTCTACAATTAAAAGG - Intronic
975212146 4:71713207-71713229 GGCTTATGTATACAATTATTAGG + Intergenic
977415584 4:96728993-96729015 GGCTTATGACTGCTATTGAGAGG + Intergenic
980527459 4:134010899-134010921 CCCTTATGTCAACTATTAAAGGG - Intergenic
982106255 4:152014382-152014404 GGCTGATGGATACTATTAAACGG + Intergenic
1001991184 5:176116686-176116708 TGCTTATTTCTGCTATAAACTGG - Intronic
1002225690 5:177721450-177721472 TGCTTATTTCTGCTATAAACTGG + Intronic
1010119169 6:72353739-72353761 TGTTTATGTCTACAAATAACAGG + Intronic
1011886359 6:92100569-92100591 GGCTCATGTCTTCTTTCAACAGG + Intergenic
1011894966 6:92214539-92214561 GGCAAATGACAACTATTAACAGG - Intergenic
1017241929 6:152180073-152180095 GGCTTATGTGTACTTTTCACAGG - Intronic
1023020790 7:36010287-36010309 GGCATGTGTCTTCCATTAACAGG - Intergenic
1045398512 8:101786070-101786092 GACCTATATGTACTATTAACTGG - Intronic
1052458582 9:28733065-28733087 CTCTTAAGTATACTATTAACAGG - Intergenic
1053158134 9:35793974-35793996 GGATTATGTCTTCTTTTACCTGG + Exonic
1056735705 9:89207896-89207918 GGCTTATCTCCACTATTCACAGG + Intergenic
1056919239 9:90771691-90771713 GGATTCTGTCTTCTAATAACAGG - Intergenic
1057989934 9:99758041-99758063 TGCTTGTGTCTACTTTTCACTGG - Intergenic
1186338002 X:8612830-8612852 GTCTTATGTCTACTAAAAAATGG + Intronic
1193626199 X:83823603-83823625 GGCTTATGTCATCTACAAACAGG - Intergenic
1199971428 X:152864713-152864735 GGCTCATCTCTACTACTAAAGGG - Intronic