ID: 1091596411

View in Genome Browser
Species Human (GRCh38)
Location 12:1881858-1881880
Sequence TTATGTCTACTATTAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091596407_1091596411 -3 Left 1091596407 12:1881838-1881860 CCCAAATTTGGCCAGATGGCTTA 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1091596411 12:1881858-1881880 TTATGTCTACTATTAACAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 280
1091596408_1091596411 -4 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596411 12:1881858-1881880 TTATGTCTACTATTAACAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 280
1091596402_1091596411 28 Left 1091596402 12:1881807-1881829 CCCCTTTAAAGTAGATTAATGAG 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1091596411 12:1881858-1881880 TTATGTCTACTATTAACAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 280
1091596404_1091596411 26 Left 1091596404 12:1881809-1881831 CCTTTAAAGTAGATTAATGAGCT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1091596411 12:1881858-1881880 TTATGTCTACTATTAACAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 280
1091596403_1091596411 27 Left 1091596403 12:1881808-1881830 CCCTTTAAAGTAGATTAATGAGC 0: 1
1: 0
2: 3
3: 18
4: 184
Right 1091596411 12:1881858-1881880 TTATGTCTACTATTAACAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091596411 Original CRISPR TTATGTCTACTATTAACAGG TGG Intronic
901099130 1:6705772-6705794 TTATGTTTACTATTTAAAGATGG - Intergenic
902102068 1:13998781-13998803 TTCTGTCTAATATTGACAGTGGG - Intergenic
904856202 1:33499916-33499938 TGGTGTTTGCTATTAACAGGTGG - Intergenic
906579310 1:46922994-46923016 ATATGTCTAATATTGACAGTGGG + Intergenic
906604404 1:47155878-47155900 ATATGTCTAATATTGACAGTGGG - Intergenic
906739708 1:48170893-48170915 ATATGTCTAATATTGACAGTGGG + Intergenic
907225028 1:52937926-52937948 TTATACCTACTGTTAAAAGGGGG + Intronic
909276066 1:73688607-73688629 ATCTGTCTAATATTAACAGTGGG + Intergenic
910635452 1:89403040-89403062 ATCTGTCTACTATTGACAGTGGG + Intergenic
911551379 1:99285666-99285688 TTATGTCTTCTATTCCCAAGAGG - Intronic
911816244 1:102356128-102356150 ATATGTCTAATATTGACAGTGGG - Intergenic
912835008 1:112988379-112988401 TTATATTAACTATTAAAAGGTGG - Intergenic
913933099 1:125004649-125004671 TTCTGTCTACTTTTTACATGAGG - Intergenic
916614603 1:166427027-166427049 GTCTGTCTAATATTGACAGGGGG + Intergenic
917584723 1:176414767-176414789 ATCTGTCTACTATTGACAGTGGG + Intergenic
918141804 1:181726055-181726077 TTGTGTCTAGGATGAACAGGAGG + Exonic
918365920 1:183807519-183807541 TTACCACTACTCTTAACAGGAGG - Intronic
918413037 1:184280522-184280544 TTATGTTAACTATCAATAGGCGG + Intergenic
919518190 1:198553695-198553717 TTCTGTCTCCAATTACCAGGAGG + Intergenic
919933917 1:202239034-202239056 TATTGTCTCCTATAAACAGGGGG + Intronic
921606061 1:217156521-217156543 TTATGTCAGCTGTTACCAGGGGG + Intergenic
1065230809 10:23596660-23596682 ATATGTCTAATATTGACAGTGGG + Intergenic
1066509528 10:36081165-36081187 TGATGTCTACTATTGACAGTGGG + Intergenic
1068656420 10:59580664-59580686 TTATGTATACAATTAACTTGTGG - Intergenic
1070221847 10:74456104-74456126 ATCTGTCTAATATTAACAGTGGG - Intronic
1070980227 10:80639362-80639384 GTCTGTCTAATATTGACAGGGGG + Intronic
1071272659 10:84022474-84022496 ATCTGTCTAATATTAACAGTGGG - Intergenic
1071346923 10:84701926-84701948 TTATTTTTACTATTCACAGAAGG + Intergenic
1072237507 10:93466062-93466084 TAATTTCTACTATCAACAAGGGG + Intronic
1073728604 10:106264973-106264995 TAATGTCAACTATTGACTGGGGG + Intergenic
1073746107 10:106469739-106469761 ATCTGTCTACTATTGACAGTGGG - Intergenic
1079327905 11:19510295-19510317 TTATGTCTATTTTAAACATGAGG + Intronic
1079993494 11:27271480-27271502 ATCTGTCTAATATTAACAGTGGG + Intergenic
1080235607 11:30065212-30065234 ATCTGTCTACTATTGACAGTGGG + Intergenic
1080568753 11:33536654-33536676 TTATGCCTCCCATTAAGAGGTGG - Intergenic
1080736889 11:35024537-35024559 ATATGTCTAATATTGACAGTGGG - Intergenic
1081066453 11:38546726-38546748 TTTTGACTACTATTAAAAAGGGG + Intergenic
1081903160 11:46647151-46647173 TTATATCTCCCATTAAAAGGGGG - Intronic
1082032733 11:47617534-47617556 TTCTGTCTAATATTATCAGTGGG + Exonic
1086202019 11:84215250-84215272 CTATGCCTACTATGATCAGGTGG - Intronic
1087254783 11:95941293-95941315 TTCTGTGTATTATTAAGAGGGGG - Intergenic
1087653793 11:100899418-100899440 TTCTGTCTAATATTGACAGTGGG + Intronic
1088078051 11:105876490-105876512 ATCTGTCTACTATTGACAGTGGG + Intronic
1088383135 11:109219283-109219305 ATATGTCTAATATTGACAGTGGG + Intergenic
1090321466 11:125847406-125847428 ATCTGTCTACTATTGACAGTGGG - Intergenic
1090861615 11:130658388-130658410 TTCTGTCAACTATTAACAGTTGG - Intergenic
1091328195 11:134708122-134708144 TTCTGTCAATTATTAAAAGGGGG - Intergenic
1091596411 12:1881858-1881880 TTATGTCTACTATTAACAGGTGG + Intronic
1093597465 12:20979315-20979337 ATGTGTCTACTATTGACAGTGGG + Intergenic
1093856058 12:24104093-24104115 TTCTATCTACTATTTACATGAGG - Intergenic
1094227168 12:28058611-28058633 TTATGTATTCTATTAATGGGTGG + Intergenic
1094654933 12:32410871-32410893 TTAAGACTATTATTAACATGTGG - Intronic
1096015823 12:48273671-48273693 ATATGTCTAATATTGACAGTAGG + Intergenic
1097656385 12:62368385-62368407 ATCTGTCTAATATTAACAGTGGG + Intronic
1098336373 12:69409205-69409227 TTATGACTACTTTAAACATGAGG - Intergenic
1099090510 12:78301237-78301259 TTATGTCTAACATGAACAGTAGG - Intergenic
1099186383 12:79519994-79520016 TTATGTCTCCTTTTCTCAGGTGG - Intergenic
1099878695 12:88439537-88439559 TTCTGTCTAATATTGACAGTGGG - Intergenic
1101186538 12:102286774-102286796 ATCTGTCTAATATTAACAGTGGG + Intergenic
1101349530 12:103915962-103915984 TTATGTTTGCTATGAACAGGTGG + Intergenic
1104005213 12:124886978-124887000 TTATGTCTACTTTTCAGATGAGG + Intergenic
1106983605 13:35319667-35319689 ATATGTCTAATATTGACAGTGGG + Intronic
1107244167 13:38272475-38272497 TAATGTCTAATATTGACAGTGGG - Intergenic
1108170573 13:47737334-47737356 TTCTGTCTAATATTGACAGTGGG - Intergenic
1109733639 13:66451765-66451787 TAATGTATACTATTAACATATGG + Intronic
1110484909 13:76027415-76027437 CCATGACTACTATTGACAGGAGG + Intergenic
1110942275 13:81365092-81365114 ATCTGTCTAATATTAACAGTAGG - Intergenic
1111029654 13:82578693-82578715 TTATGTCTACTATTGTCAATGGG + Intergenic
1111080905 13:83306097-83306119 ATCTGTCTAATATTAACAGTGGG + Intergenic
1114603344 14:23973816-23973838 TTCTGTCTAATATTAACAGTGGG - Intronic
1114608324 14:24016298-24016320 TTCTGTCTAATATTAACAGTGGG - Intergenic
1115043239 14:28956685-28956707 TTCTGTCTAATATTGACAGTGGG - Intergenic
1115295213 14:31818223-31818245 TTCTGTCTAATATTGACAGTGGG - Intronic
1115650768 14:35401576-35401598 TTATGTACACCATTTACAGGAGG + Exonic
1115928586 14:38465618-38465640 ATATGTCTAATATTGACAGTGGG + Intergenic
1116315149 14:43376820-43376842 TTTTGTTTACTATTGACAGATGG + Intergenic
1116570638 14:46511122-46511144 TTCTGTCTAATATTGACAGTGGG - Intergenic
1116717357 14:48444642-48444664 ATCTGTCTACTATTGACAGTGGG - Intergenic
1117710979 14:58528269-58528291 TTCTGTCTAATATTGACAGTGGG - Intronic
1118857963 14:69638753-69638775 TTAAATCAACTATTAAAAGGTGG - Intronic
1120016514 14:79480457-79480479 TTTTGTCTTCTTTTAAGAGGCGG - Intronic
1126470453 15:49005004-49005026 TGATGTCTAATATTGACAGTGGG + Intronic
1128421937 15:67500389-67500411 TTATGTCTAATAATAACATTGGG - Intronic
1138779165 16:59761769-59761791 ATTTGTCTACTATTGACAGCGGG - Intergenic
1139162500 16:64528042-64528064 ATATGTCTCCCATTAAGAGGTGG + Intergenic
1139233652 16:65311667-65311689 ATATGTTTACCCTTAACAGGTGG + Intergenic
1142097928 16:88253840-88253862 TTTTGTCCATTTTTAACAGGTGG + Intergenic
1144294267 17:13858046-13858068 ATCTGTCTAATATTGACAGGGGG - Intergenic
1147174732 17:38647817-38647839 TTCTGTCTTCTATTAACATAGGG - Intergenic
1149404556 17:56334616-56334638 ACATGACTACTATTAACATGAGG + Intronic
1150656571 17:67043709-67043731 TTTTGCCTTCTATTAACAGCAGG - Intergenic
1151467142 17:74293224-74293246 TTATGTCTATTATTGAAAGTAGG + Intronic
1155115350 18:22760579-22760601 TTTTGGCTACATTTAACAGGGGG + Intergenic
1156143710 18:34148787-34148809 ATCTGTCTAATATTGACAGGGGG + Intronic
1156230493 18:35149761-35149783 ATCTGTCTAATATTAACAGTGGG + Intergenic
1156371801 18:36477695-36477717 TTATGTCTCCCATTAACACCTGG - Intronic
1156979093 18:43264050-43264072 ATCTGTCTAATATTGACAGGGGG + Intergenic
1158741789 18:60151101-60151123 TTATGGCTGCTATTTACATGTGG + Intergenic
1159432500 18:68372041-68372063 TAATGTCTTCTATTAACTGTGGG + Intergenic
1163990123 19:20990752-20990774 ATCTGTCTAATATTAACAGAGGG - Intergenic
1164002389 19:21113954-21113976 ATCTGTCTAATATTAACAGTGGG + Intronic
1164816388 19:31206668-31206690 TGATGTCTACTATTATCAAATGG - Intergenic
1166172084 19:41035608-41035630 TTCTGTCTAATATTGACAGTGGG - Intergenic
1166237951 19:41470063-41470085 TTGTTTCTAATATTCACAGGGGG - Intergenic
1168530583 19:57125340-57125362 ATCTATCTAATATTAACAGGGGG + Intronic
926901632 2:17757275-17757297 TTAAATATATTATTAACAGGGGG - Intronic
929582697 2:43093115-43093137 TTGTGTCTACAACTTACAGGAGG - Intergenic
930478327 2:51913858-51913880 TTCTGTCTAATATTGACAGTGGG - Intergenic
931560694 2:63557576-63557598 TTCTGTCTAATATTGACAGTGGG - Intronic
931815152 2:65892844-65892866 TTCTGTCTAATATTAACAGTGGG - Intergenic
931971483 2:67591473-67591495 ATCTGTCTAATATTGACAGGGGG - Intergenic
931985941 2:67742534-67742556 ATCTGTCTAATATTGACAGGGGG + Intergenic
933488024 2:82948166-82948188 ATATGTCTAATATTGACAGTGGG + Intergenic
935566197 2:104609869-104609891 ATCTGTCTAATATTGACAGGAGG - Intergenic
935604485 2:104957183-104957205 ATCTGTCTAATATTGACAGGGGG + Intergenic
936260297 2:110954156-110954178 TTTTGTCTAATATTAACATAAGG + Intronic
936910117 2:117581800-117581822 TTCTGTCTAATATTGACAGTGGG - Intergenic
939055796 2:137362801-137362823 ATCTGTCTACTATTGACAGTGGG - Intronic
939331015 2:140761139-140761161 TACAGTCTACTATTAACTGGAGG + Intronic
939468633 2:142590811-142590833 TTATATCTACTATAAATATGAGG - Intergenic
939468635 2:142590873-142590895 TTATATCTACTATAAATATGAGG - Intergenic
940808089 2:158210377-158210399 TTCTGTCTAATATTGACAGTGGG - Intronic
940891443 2:159039927-159039949 TTCTGTCTAATATTGACAGTGGG + Intronic
941175187 2:162188644-162188666 TTATGTCTGCTTTTAGCAAGTGG - Intronic
941515407 2:166468857-166468879 TTAAGTTTACTATTAACATGCGG + Intronic
941571384 2:167175157-167175179 ATCTGTCTACTATTGACAGTGGG + Intronic
941608726 2:167633760-167633782 TTCTGTCTAATATTGACAGTGGG - Intergenic
941668517 2:168265363-168265385 TTATGTATATTTTTAACAGATGG + Intergenic
941681620 2:168405858-168405880 TTATTTCTGCTATTAATAGTTGG - Intergenic
942407474 2:175670878-175670900 ATCTGTCTAATATTAACAGTTGG - Intergenic
944000148 2:194824676-194824698 TTTTGTCTATTTTTAACAAGAGG + Intergenic
947483816 2:230527994-230528016 ATATGTCTAATATTGACAGTGGG - Intronic
1169960086 20:11150357-11150379 TTCTGTCTAATATTGACAGTGGG + Intergenic
1170042111 20:12050030-12050052 TAATGTGAAATATTAACAGGTGG + Intergenic
1171819330 20:29819273-29819295 ATCTGTCTAATATTAACAGTGGG - Intergenic
1172250413 20:33475599-33475621 TTATTATTACTATTACCAGGGGG + Intergenic
1172321184 20:33995981-33996003 TTATGGTTAGTATTAAGAGGAGG + Intronic
1172712960 20:36941164-36941186 TTATGTCTACTATATACTGCAGG - Intronic
1173354234 20:42271958-42271980 TTATGATTACTATTTACTGGTGG - Intronic
1177304438 21:19294779-19294801 TTCTGTCTAATATTGACAGTGGG - Intergenic
1179612483 21:42561304-42561326 TTATGTCTACTTTTAGAAAGAGG - Intronic
1180323319 22:11343969-11343991 ATCTGTCTAATATTAACAGTGGG - Intergenic
1184056008 22:42050036-42050058 TTATATCTAAAATTTACAGGTGG + Intronic
949804249 3:7936782-7936804 TTCTGTCTAATATTGACAGTGGG - Intergenic
951417757 3:22446095-22446117 ATCTGTCTAATATTAACAGTGGG + Intergenic
951471360 3:23060173-23060195 ATCTGTCTAATATTAACAGTGGG + Intergenic
951747564 3:25996693-25996715 ATCTGTCTAATATTTACAGGGGG + Intergenic
953074317 3:39553766-39553788 TTCTGTCTAATATTGACAGTGGG - Intergenic
953433660 3:42860416-42860438 ATCTGTCTACTATTGACAGTGGG - Intronic
954536872 3:51367065-51367087 ATCTGTCTAGTATTAACAGTGGG + Intronic
954987107 3:54804616-54804638 ATCTGTCTAATATTAACAGTGGG - Intronic
955181873 3:56679958-56679980 TTATGTTTACTATCAACATTTGG - Intronic
955850852 3:63218180-63218202 CTATGTCTAATATTTACAGGAGG + Intergenic
956080730 3:65552898-65552920 TTATGTCTCCTGTTCACAGATGG + Intronic
957475086 3:80711991-80712013 TTCTGTCTAATATTGACAGTAGG - Intergenic
957611299 3:82470548-82470570 TTATCTCTTTTATTAAAAGGGGG + Intergenic
959041851 3:101431256-101431278 ATCTGTCTAATATTAACAGTAGG + Intronic
959418113 3:106102109-106102131 ATATGTCTAATATTGACAGTTGG + Intergenic
959657535 3:108826361-108826383 ATGTGTCTATTATGAACAGGGGG - Intronic
960566044 3:119132637-119132659 ATCTGTCTACTATTGACAGTGGG - Intronic
962245395 3:133786385-133786407 CAATGTGTATTATTAACAGGTGG - Intronic
962562586 3:136622515-136622537 TGATGTCTCCTATTAAAAGGAGG + Intronic
963562468 3:146883203-146883225 TAATTTCTACTATTAAAAGCAGG - Intergenic
964081561 3:152764829-152764851 ATCTGTCTAATATTGACAGGGGG - Intergenic
965025736 3:163299134-163299156 ATCTGTCTAATATTAACAGTGGG - Intergenic
966109998 3:176389516-176389538 TTATCTATACTATTAATAGTGGG - Intergenic
970351935 4:15210008-15210030 CGATGTATACTATTAAGAGGTGG - Intergenic
971238623 4:24867252-24867274 TCATGTCCACTATGAACAGGAGG + Intronic
971783262 4:31066814-31066836 TTTTGTCTACTATTTGGAGGTGG - Intronic
973127212 4:46601833-46601855 TCGTGTCTACTACTAACAGAGGG + Intergenic
973341601 4:49011052-49011074 ATATGTCTAATATTGACAGTGGG + Intronic
973584912 4:52380128-52380150 ATATGTCTAATATTGACAGTGGG - Intergenic
973799524 4:54462663-54462685 ATCTGTCTACTATTGACAGTGGG - Intergenic
975227776 4:71893946-71893968 ATATGTCTAATATTGACAGTGGG - Intergenic
976819551 4:89189930-89189952 ATATGTCTAATATTGACAGTGGG + Intergenic
977425805 4:96865419-96865441 ATATGTCTAATATTGACAGGGGG - Intergenic
977511438 4:97967423-97967445 ATATGTCTACTATTGACAGTGGG - Intronic
977985872 4:103382050-103382072 ATATGTATACTATTACCAGTGGG - Intergenic
978471446 4:109072000-109072022 TTTTGGCTACTATTAACATGAGG + Intronic
980261729 4:130458087-130458109 ATATGTCTAATATTGACAGTGGG + Intergenic
980330150 4:131401188-131401210 TTCTGTCTAATATTGACAGTGGG + Intergenic
980816957 4:137960404-137960426 TTATGTTAACTAATAACAGAAGG + Intergenic
981411512 4:144437492-144437514 ATCTGTCTAATATTGACAGGGGG - Intergenic
983596051 4:169469695-169469717 ATATGTCTAATATTGACAGTGGG + Intronic
983972133 4:173888628-173888650 ATCTGTCTAATATTAACAGTGGG + Intergenic
984162931 4:176275903-176275925 TTCTGTCTTCTATACACAGGTGG - Intronic
987292638 5:16523136-16523158 TAATGTAAAATATTAACAGGGGG - Intronic
989735452 5:44698444-44698466 GTATCTCTACTATAAACAGGTGG - Intergenic
992314067 5:75534541-75534563 ATATGTCTAATATTATCAGTGGG + Intronic
993471095 5:88308296-88308318 ATCTGTCTAATATTGACAGGGGG - Intergenic
993513161 5:88797201-88797223 TTCTGTCTAATATTGACAGTGGG + Intronic
994137706 5:96307026-96307048 ATCTGTCTAATATTAACAGTGGG + Intergenic
994160564 5:96551983-96552005 TTCTGTCTAATATTGACAGTGGG - Intronic
994339344 5:98607694-98607716 TCATGTCTACTTTTAAGAGATGG - Intergenic
995108524 5:108401798-108401820 TTCTGTCTAATATTGACAGTGGG - Intergenic
995620866 5:114023814-114023836 ATCTGTCTAATATTAACAGTGGG - Intergenic
996163469 5:120195679-120195701 TTCTGTCTAATATTGACAGTGGG - Intergenic
996242857 5:121224093-121224115 TTCTGTCTACTATTAACAGTGGG - Intergenic
998691358 5:144592307-144592329 ATCTGTCTAATATTAACAGTGGG + Intergenic
998755366 5:145372422-145372444 TTCTGTCTAATATTGACAGTGGG + Intergenic
999559981 5:152790119-152790141 ATCTGTCTAATATTAACAGTGGG - Intergenic
1000375880 5:160581725-160581747 ATCTGTCTACTATTGACAGTGGG + Intronic
1000553389 5:162694342-162694364 TTCTGTCTAATATTGACAGTGGG + Intergenic
1003249002 6:4408234-4408256 TTCTGTCTAATATTGACAGTGGG - Intergenic
1005772899 6:29094261-29094283 TAATTTGTACTATTGACAGGAGG + Intergenic
1005785597 6:29242555-29242577 ATCTGTCTAATATTAACAGTGGG + Intergenic
1008258214 6:49331177-49331199 TTATGGGTACTAATAACAAGTGG - Intergenic
1009255662 6:61392590-61392612 TTCTGTCTACTATTAATATGAGG - Intergenic
1010426724 6:75736021-75736043 TTATGTTTATTATTAACTGTAGG + Intergenic
1011108994 6:83815281-83815303 TTATGTCTTCTAATCACATGAGG - Intergenic
1011417992 6:87142246-87142268 ATATGTCTAATATTGACAGTGGG - Intergenic
1011932608 6:92732688-92732710 TTCTGTCTAATATTGACAGTGGG - Intergenic
1012245229 6:96918885-96918907 TTAAGTCTACTTTTAAAAGATGG + Intergenic
1012311960 6:97736614-97736636 ATCTGTCTAATATTAACAGTGGG + Intergenic
1012554971 6:100500153-100500175 ATCTGTCTACTATTGACAGTGGG - Intergenic
1012568146 6:100686140-100686162 TTATGTATACTAAAAACATGGGG + Intronic
1012871136 6:104673633-104673655 TTCTGTCTAATATTGACAGTGGG - Intergenic
1013200451 6:107890144-107890166 TTCTGTCTAATATTGACAGTGGG + Intronic
1013919846 6:115391201-115391223 ATCTGTCTAATATTAACAGTGGG + Intergenic
1013973027 6:116043151-116043173 GTCTGTCTAATATTAACAGTGGG - Intronic
1014859210 6:126443477-126443499 TAATGTGTACTTTTATCAGGAGG + Intergenic
1014902525 6:126985043-126985065 ATTTGTCTAATATTGACAGGGGG - Intergenic
1015883016 6:137888944-137888966 TTCTGTCTAATATTGACAGTGGG + Intergenic
1016368733 6:143347687-143347709 TAATGACTACTATAAAAAGGAGG + Intergenic
1016478040 6:144449953-144449975 TTATGTCTATTATTAACTCAAGG - Intronic
1017100379 6:150844644-150844666 TTATGTTTACCATTTACACGGGG - Intergenic
1017393216 6:153964523-153964545 GTATGTCTACTCTAAACATGGGG - Intergenic
1017695588 6:157012562-157012584 TAATGTCTTCTATTTACAGTTGG - Intronic
1018404987 6:163470734-163470756 ATTTACCTACTATTAACAGGTGG + Intronic
1020343946 7:7143157-7143179 ATCTGTCTAATATTAACAGTGGG + Intergenic
1020519325 7:9166936-9166958 TTCTGTCTAATATTGACAGTGGG + Intergenic
1021105890 7:16639222-16639244 TTAAGTCTACTATGGACAGTAGG - Intronic
1021224319 7:18010509-18010531 ATATGTCTAATATTGACAGTGGG + Intergenic
1021238499 7:18173027-18173049 ATCTGTCTAATATTAACAGTGGG + Intronic
1023002476 7:35824579-35824601 TGATTTCTACTTTTAACAGTTGG + Intronic
1023020787 7:36010284-36010306 ATGTGTCTTCCATTAACAGGGGG - Intergenic
1029850847 7:103460327-103460349 ATATGTCTAATATTGACAGTGGG + Intergenic
1030241430 7:107330745-107330767 TTATTTCTACTATTTACATGAGG - Intronic
1030363781 7:108623793-108623815 TTATGTCTATTGTAAACAGGAGG + Intergenic
1031311846 7:120208335-120208357 TTCTGTCTAATATTGACAGTGGG - Intergenic
1031694694 7:124835411-124835433 TTATTTATTCTCTTAACAGGAGG - Exonic
1035970960 8:4248502-4248524 ATATGTCAACTTCTAACAGGAGG + Intronic
1036042571 8:5102233-5102255 ATATATCTACTATTAATATGTGG - Intergenic
1036089210 8:5647132-5647154 TAATGGCTGCTATTATCAGGTGG + Intergenic
1036554011 8:9841209-9841231 ATCTGTCTAATATTAACAGTGGG - Intergenic
1039676524 8:39674199-39674221 ATCTGTCTAATATTGACAGGGGG + Intronic
1040123475 8:43708633-43708655 ATCTGTCTAATATTAACAGTGGG + Intergenic
1040613044 8:49005108-49005130 ATCTGTCTAATATTGACAGGGGG + Intergenic
1041913793 8:63119098-63119120 TTATGCCCATTATGAACAGGTGG - Intergenic
1042473370 8:69216572-69216594 TTATGTCTAATATTGTCAGTGGG - Intergenic
1042853267 8:73238415-73238437 ATCTGTCTAATATTCACAGGGGG + Intergenic
1043686086 8:83087655-83087677 TGATGTCTACTATCAACAAGTGG - Intergenic
1043816085 8:84803222-84803244 TTATTTCAAGTATTATCAGGTGG + Intronic
1043844826 8:85152245-85152267 ATATGTCTAATATTGACAGTGGG - Intergenic
1044254807 8:90047599-90047621 TTCTGTCTAATATTGACAGTGGG - Intronic
1044314344 8:90732332-90732354 ATCTGTCTAATATTAACAGTGGG + Intronic
1044615381 8:94135235-94135257 ATATGTCTAATATTGACAGTGGG + Intronic
1045199925 8:99969798-99969820 ATCTGTCTAATATTGACAGGGGG - Intronic
1045877778 8:107002299-107002321 TCTTGTCTACTATTGACAGTGGG - Intergenic
1047646293 8:126873987-126874009 TAATGTATTCTATTAAAAGGAGG + Intergenic
1047931784 8:129735221-129735243 ATCTGTCTAATATTAACAGTGGG - Intergenic
1050015610 9:1229907-1229929 TTATGTACACCATTAATAGGTGG - Intergenic
1051338292 9:16087306-16087328 TTCTGTCTAATATTGACAGTGGG + Intergenic
1052143778 9:25023127-25023149 ATCTGTCTAATATTGACAGGAGG + Intergenic
1052200004 9:25766443-25766465 ATCTGTCTAGTATTAACAGTGGG - Intergenic
1052217565 9:25985129-25985151 TTTTGTCTAATATTGACAGTTGG - Intergenic
1052280966 9:26733150-26733172 TTCTGTCTAATATTGACAGTGGG + Intergenic
1052667754 9:31516951-31516973 ATCTGTCTAATATTAACAGTTGG + Intergenic
1053538627 9:38950529-38950551 TTATGTAAAATATTAAAAGGAGG - Intergenic
1054627511 9:67413387-67413409 TTATGTAAAATATTAAAAGGAGG + Intergenic
1058031362 9:100201605-100201627 TTATGTCTATAATTAGCAAGTGG - Intronic
1060561635 9:124549766-124549788 TTATGTCCATTGTTAAAAGGAGG - Intronic
1203370997 Un_KI270442v1:304540-304562 ATCTGTCTAATATTAACAGTGGG - Intergenic
1186119851 X:6348845-6348867 TTTTTTCTTCTATTAGCAGGTGG + Intergenic
1189667445 X:43372064-43372086 TTGTTTCTCCTATTAACAGCTGG - Intergenic
1189938024 X:46089680-46089702 ATCTGTCTAATATTAACAGTGGG - Intergenic
1189939857 X:46110380-46110402 ATCTGTCTAATATTAACAGTGGG + Intergenic
1191200244 X:57772904-57772926 TGATGTTTATTATTATCAGGAGG - Intergenic
1191645945 X:63480884-63480906 ATCTGTCTAATATTAACAGTGGG - Intergenic
1192628791 X:72758559-72758581 TTCTGTCTAATATTGACAGGGGG + Intergenic
1192652919 X:72962255-72962277 TTCTGTCTAATATTGACAGGGGG - Intergenic
1192994238 X:76495208-76495230 TTTTGTCTAATATTGACAGTGGG - Intergenic
1193034717 X:76936792-76936814 ATCTGTCTAATATTAACAGTGGG - Intergenic
1193408810 X:81138826-81138848 TTCTATATACTATGAACAGGTGG + Intronic
1194158783 X:90424991-90425013 TTCTGTCTAATATTGACAGTGGG - Intergenic
1194254621 X:91621448-91621470 ATATGTCTAATATTGACAGTGGG + Intergenic
1194487750 X:94506505-94506527 TTATGTCTTCTTTTGAAAGGTGG - Intergenic
1194559766 X:95405493-95405515 ATATGTCTAATATTGACAGTGGG - Intergenic
1194901153 X:99513579-99513601 ATCTGTCTACTATTGACAGTGGG + Intergenic
1195725433 X:107910669-107910691 TAATGGCTATTATTAAAAGGAGG - Intronic
1196054719 X:111342481-111342503 ATATGTCTAATATTGACAGTGGG - Intronic
1196474971 X:116072782-116072804 ATCTGTCTAATATTGACAGGGGG - Intergenic
1196555639 X:117081834-117081856 ATATGTCTAATATTGACAGTGGG + Intergenic
1197098082 X:122619401-122619423 ATATGTCTAATATTGACAGTGGG + Intergenic
1197423809 X:126270954-126270976 ATATGTCTAATATTGACAGTAGG + Intergenic
1198393843 X:136203446-136203468 TTATGGGTACTATTAACTTGGGG + Intronic
1198490202 X:137132019-137132041 ATCTGTCTAATATTAACAGGGGG - Intergenic
1198758241 X:140003012-140003034 ATCTGTCTACTATTGACAGTGGG - Intergenic
1199007551 X:142719808-142719830 ATATGTCTAATATTGACAGTGGG - Intergenic
1200505098 Y:4001958-4001980 TTCTGTCTAATATTGACAGTGGG - Intergenic
1200573404 Y:4861053-4861075 TGATGTCTAATATTGACAGTGGG + Intergenic
1201186305 Y:11406718-11406740 ATATGTCTAATATTGACAGTGGG - Intergenic
1201597249 Y:15684509-15684531 TTCTGTCTAATATTGACAGTGGG + Intergenic