ID: 1091596412

View in Genome Browser
Species Human (GRCh38)
Location 12:1881861-1881883
Sequence TGTCTACTATTAACAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091596408_1091596412 -1 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596412 12:1881861-1881883 TGTCTACTATTAACAGGTGGAGG 0: 1
1: 0
2: 2
3: 5
4: 99
1091596403_1091596412 30 Left 1091596403 12:1881808-1881830 CCCTTTAAAGTAGATTAATGAGC 0: 1
1: 0
2: 3
3: 18
4: 184
Right 1091596412 12:1881861-1881883 TGTCTACTATTAACAGGTGGAGG 0: 1
1: 0
2: 2
3: 5
4: 99
1091596407_1091596412 0 Left 1091596407 12:1881838-1881860 CCCAAATTTGGCCAGATGGCTTA 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1091596412 12:1881861-1881883 TGTCTACTATTAACAGGTGGAGG 0: 1
1: 0
2: 2
3: 5
4: 99
1091596404_1091596412 29 Left 1091596404 12:1881809-1881831 CCTTTAAAGTAGATTAATGAGCT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1091596412 12:1881861-1881883 TGTCTACTATTAACAGGTGGAGG 0: 1
1: 0
2: 2
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091596412 Original CRISPR TGTCTACTATTAACAGGTGG AGG Intronic
903161776 1:21494239-21494261 TGTTTACTATTAAAAAGTGAGGG - Intergenic
904856199 1:33499913-33499935 TGTTTGCTATTAACAGGTGGGGG - Intergenic
912529486 1:110310070-110310092 TGTGGACTATAAACATGTGGGGG - Intergenic
915301689 1:154955263-154955285 TGCTGACTGTTAACAGGTGGTGG + Intronic
916422324 1:164648586-164648608 TCTCTACTATTTACAGGTTTTGG - Intronic
918290596 1:183103786-183103808 TGTGTACTATTAATAAGTGAAGG + Intronic
918646170 1:186907825-186907847 TGACTTATATTAACAGGTTGTGG - Intronic
921169462 1:212533615-212533637 AGTCTACTTGTTACAGGTGGAGG - Intergenic
1065254147 10:23848291-23848313 TGTCTAATATTGACAGTGGGGGG + Intronic
1065396215 10:25240974-25240996 TGTTTTCTATTAAGAGGTTGAGG + Intronic
1068852982 10:61765712-61765734 TGTCTGCTATGAACAGGAAGTGG - Intronic
1072155135 10:92717014-92717036 GGTCTACTATTGCCAGGTGAAGG - Intergenic
1072224568 10:93356540-93356562 TGGCAAATATTAACAGGTTGAGG - Intronic
1077382170 11:2249261-2249283 TGTCAACACTTAACAGCTGGGGG - Intergenic
1082855398 11:57801848-57801870 TGTCTCCAATTAGGAGGTGGAGG - Exonic
1083385261 11:62304229-62304251 TGTCTAATATTAACAGTGAGGGG + Intergenic
1088860397 11:113793668-113793690 TGTCTCCTAGTATCTGGTGGGGG - Intergenic
1089737617 11:120561019-120561041 TGTCTACTATTCAAAGGCTGTGG - Intronic
1090861612 11:130658385-130658407 TGTCAACTATTAACAGTTGGGGG - Intergenic
1091596412 12:1881861-1881883 TGTCTACTATTAACAGGTGGAGG + Intronic
1094339080 12:29390067-29390089 TGTTTTCTATTAAAAGGTTGGGG - Intergenic
1094430496 12:30363922-30363944 TGTGTAATATTAACAGATAGTGG - Intergenic
1098528131 12:71510457-71510479 TGTCTACATTTTATAGGTGGTGG - Intronic
1099186382 12:79519991-79520013 TGTCTCCTTTTCTCAGGTGGAGG - Intergenic
1101957028 12:109221078-109221100 TTTCTATTATTAAACGGTGGTGG - Intronic
1103569257 12:121833585-121833607 TGGCAAATATTAAAAGGTGGAGG + Intergenic
1104177334 12:126345684-126345706 TGTCCCCTAGTAACAGGTGGTGG - Intergenic
1105072599 12:133244308-133244330 TGTCAAAAATTAACAGGTGCTGG - Intergenic
1112592958 13:100781197-100781219 TGTCTACTTTGAAGAGTTGGAGG + Intergenic
1112949816 13:104979221-104979243 TGTCTTCAATTTTCAGGTGGAGG + Intergenic
1120839100 14:89067617-89067639 AGACTACTAGTAGCAGGTGGAGG + Intergenic
1125956774 15:43795819-43795841 GGTCTAGTATTAAAAAGTGGAGG + Intronic
1130707824 15:86249821-86249843 TGTCTACGATAGAAAGGTGGTGG + Intronic
1131471234 15:92699157-92699179 GGTTTTCTTTTAACAGGTGGTGG - Intronic
1132407166 15:101550602-101550624 TTTCCACTATGAACAGGTGTTGG - Intergenic
1139180365 16:64740314-64740336 TGACAACTATTAAGAGGTGAGGG + Intergenic
1140788054 16:78362720-78362742 TGTCTACTATTTTTAGGTTGAGG - Intronic
1166220719 19:41362837-41362859 GGTCTCCAATTAATAGGTGGGGG + Intronic
1167869453 19:52355625-52355647 AATCTACTACTAACAAGTGGTGG - Intronic
1168073889 19:53968461-53968483 AGTCTACTATTAAAATGTGAGGG + Intronic
935038249 2:99400177-99400199 TCTCTACTGTTACCAGGTGCTGG - Exonic
935176333 2:100652613-100652635 TGTGTTCTGTTCACAGGTGGTGG - Intergenic
939491990 2:142887274-142887296 TGACTACTATTAAAAAGTGCAGG + Intronic
939863578 2:147446835-147446857 TGTCCACTATCATCAGCTGGGGG - Intergenic
941012240 2:160313503-160313525 TGTCTTGTATTTACTGGTGGGGG + Intronic
947165932 2:227262191-227262213 TATCTACTATTAACAGTTTGAGG - Intronic
948627945 2:239280681-239280703 TGTCTGCTGTTAACAGGGGATGG + Intronic
1170903751 20:20491962-20491984 TGTGTATTATTAAGAGGAGGCGG + Intronic
1172581150 20:36050144-36050166 TGTTTTCTATTAAAAGGTTGGGG + Intergenic
1178513754 21:33229545-33229567 TTTATACAATTAACAAGTGGGGG + Intergenic
949846363 3:8374448-8374470 TGTCTAATATTGACAGTGGGGGG - Intergenic
954035631 3:47849539-47849561 AGTCGACCATTAACAGGTGAGGG + Exonic
954750092 3:52808666-52808688 TGTCTACTCAAAACAGGTTGGGG - Exonic
960322871 3:116258575-116258597 TGTGTACTATAATCAGGTGATGG + Intronic
963627295 3:147689546-147689568 TGTCTACAACTAGTAGGTGGGGG + Intergenic
966208224 3:177426235-177426257 TTTCTGGTATTAACATGTGGGGG - Intergenic
966985741 3:185178812-185178834 TCTCCACTATTTAGAGGTGGGGG + Intergenic
969630599 4:8333676-8333698 TGTCTACTATGAACTGGAAGTGG - Intergenic
970651466 4:18183510-18183532 TGTCTGCCATTAACAGGTCTAGG - Intergenic
971545713 4:27882839-27882861 TGTCTACTATTAAAAATTGAAGG + Intergenic
971619009 4:28829851-28829873 TCTCTACTAAAAATAGGTGGTGG + Intergenic
974277274 4:59739429-59739451 TGTGGACTATTAGAAGGTGGAGG - Intergenic
974302323 4:60083843-60083865 TGTCTAGTATTAACAATGGGGGG - Intergenic
974939138 4:68442732-68442754 TGTCTATTGCTAACAGATGGTGG - Intergenic
978618025 4:110614988-110615010 TGCCTGCTAGTAACAGGTGAGGG + Intergenic
978708885 4:111752430-111752452 TGTCTTCTATTAATAATTGGTGG + Intergenic
979862387 4:125709588-125709610 TCTCTACTATTTATAGGGGGAGG - Intergenic
980020701 4:127706502-127706524 TGTGTACTATTAGAAGCTGGAGG + Exonic
980483967 4:133428948-133428970 TGTCTGTTATTATCATGTGGAGG + Intergenic
986071079 5:4284065-4284087 TGTCTATTTTTAAAATGTGGAGG - Intergenic
986601995 5:9481702-9481724 TCTCTAATAATTACAGGTGGCGG + Intronic
986732837 5:10648204-10648226 TGTCTACCTTTAACCGATGGTGG - Intronic
986965446 5:13264895-13264917 TGGCTACTATAAAGAGGTTGAGG + Intergenic
987668046 5:20970473-20970495 TATCTACTATTAATATGTGTTGG + Intergenic
987989253 5:25190211-25190233 TGTTTTCTATTAAAAGGTTGGGG + Intergenic
990956163 5:61341765-61341787 TGTATACTATTTACCGGTGAAGG - Intronic
992011318 5:72530511-72530533 TTTCTACGATTAGCATGTGGGGG + Intergenic
995422189 5:111980165-111980187 AGTCGACTATGGACAGGTGGAGG + Intronic
997045035 5:130305729-130305751 TGTCTACTATTAACAGATACTGG + Intergenic
1001988500 5:176096068-176096090 AGTCTCCTACTCACAGGTGGAGG + Intronic
1002228368 5:177742065-177742087 AGTCTCCTACTCACAGGTGGAGG - Intronic
1002492175 5:179586424-179586446 TGTCTCCTGTTAGCAGGAGGGGG + Intronic
1005512465 6:26522502-26522524 TGTTTTCTATTAAAAGGTTGGGG - Intergenic
1008394294 6:50989175-50989197 TTTGTACTTTTAACAGGTGAAGG - Intergenic
1008997214 6:57672942-57672964 TCTCTAGGATTAAGAGGTGGGGG - Intergenic
1009331200 6:62422945-62422967 TGTCCACTATCTACAAGTGGTGG - Intergenic
1012075270 6:94674779-94674801 TGTCTAATATTGACAGTGGGGGG - Intergenic
1016525164 6:144993273-144993295 TTTATCCAATTAACAGGTGGTGG + Intergenic
1027748702 7:82112717-82112739 TGTAAACTATTAGCAAGTGGTGG + Intronic
1028040459 7:86046021-86046043 TGTCTTCTATTAAGAAGTGTCGG - Intergenic
1028799584 7:94947822-94947844 TGTATGCTAATAACAGGTGCAGG + Intronic
1030929243 7:115501793-115501815 AGTCAACAAATAACAGGTGGTGG + Intergenic
1031711268 7:125048869-125048891 TGTCTAATATTGACAGTGGGGGG - Intergenic
1032557872 7:132856800-132856822 TGTCTACTTCTATCAGGAGGAGG - Intronic
1035493184 7:159297755-159297777 TGTCAAAAATTAACAGGTGCTGG - Intergenic
1041304336 8:56445273-56445295 TCTCTCCTATTTACAGGTGAGGG + Intronic
1043463334 8:80482512-80482534 TGCCTACTATGTACTGGTGGGGG + Intergenic
1045784733 8:105907662-105907684 TGTCTACTACTGATTGGTGGTGG - Intergenic
1047570981 8:126098542-126098564 TGTCTACTTTGAACACATGGAGG + Intergenic
1047584215 8:126251901-126251923 TGGCTACTATGAATAGGTGGTGG - Intergenic
1047787481 8:128167959-128167981 TGTCTGCTTTTAAAGGGTGGGGG - Intergenic
1057263372 9:93598554-93598576 TGCCTGCTATTAGCAGGTGATGG - Intronic
1058155242 9:101507417-101507439 TGTCTCCTATTTACAGGTCTGGG - Intronic
1193397502 X:81003418-81003440 TGTTTTCTATTAAAAGGTTGGGG + Intergenic
1194523834 X:94951342-94951364 TGTTTCCTATTATCAGGAGGTGG + Intergenic
1198793683 X:140373417-140373439 TGTCTACTAGTTACAGGTGTAGG - Intergenic
1199100055 X:143789235-143789257 TGTCTTCTATTCACAAGTGATGG + Intergenic