ID: 1091596413

View in Genome Browser
Species Human (GRCh38)
Location 12:1881886-1881908
Sequence AGTAAGCATGCCACTGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091596409_1091596413 14 Left 1091596409 12:1881849-1881871 CCAGATGGCTTATGTCTACTATT 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1091596413 12:1881886-1881908 AGTAAGCATGCCACTGCTTTTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1091596408_1091596413 24 Left 1091596408 12:1881839-1881861 CCAAATTTGGCCAGATGGCTTAT 0: 1
1: 0
2: 3
3: 12
4: 103
Right 1091596413 12:1881886-1881908 AGTAAGCATGCCACTGCTTTTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1091596407_1091596413 25 Left 1091596407 12:1881838-1881860 CCCAAATTTGGCCAGATGGCTTA 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1091596413 12:1881886-1881908 AGTAAGCATGCCACTGCTTTTGG 0: 1
1: 0
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091596413 Original CRISPR AGTAAGCATGCCACTGCTTT TGG Intronic
902545540 1:17187313-17187335 AAAAAGCATGCCCCTTCTTTGGG - Intergenic
903114995 1:21171772-21171794 ACTAACCATGCAACTGCTTCAGG - Intronic
904536264 1:31201696-31201718 GGCAAGCCTGCCACTGCTCTGGG - Intronic
906699458 1:47847325-47847347 TGAAAGCATGCAACTCCTTTTGG + Intronic
908089371 1:60670242-60670264 AGTTTGCAAGCCACTGCTGTAGG + Intergenic
909549527 1:76882274-76882296 ATTAAGCATGACACTCCTTTTGG - Intronic
909991442 1:82227330-82227352 AGCAATCATGCCCATGCTTTTGG + Intergenic
913034802 1:114953673-114953695 AGTAAGCATGGCAGTGATATTGG - Intronic
916936524 1:169633533-169633555 AGTAAGTATGCCTGTGCCTTGGG + Intergenic
917420242 1:174855621-174855643 AGTAAGCATTCCACTTCTATGGG + Intronic
918376205 1:183911708-183911730 AGAAGGGATGGCACTGCTTTGGG - Intronic
922897981 1:229115244-229115266 TGTAAGCATGGCACTGTGTTAGG - Intergenic
1070481533 10:76887583-76887605 AGTAACCAGGCCATTGCTTTTGG - Intronic
1073119164 10:101111139-101111161 ATTAAGCTTGCCACTGCTGCTGG - Intronic
1073545172 10:104341870-104341892 ATTAAGCATAACACTGGTTTGGG - Intergenic
1073613319 10:104967097-104967119 ACTAAACATGCCACTGCCTTAGG - Intronic
1078366804 11:10713648-10713670 AGTAAGCATTCCACTTCTGCAGG + Intergenic
1080540737 11:33262194-33262216 AGGAAGAATGTCACTTCTTTTGG + Intronic
1080700548 11:34640460-34640482 AGTAACCTTTCCACTGCTTGTGG + Intronic
1081302640 11:41471512-41471534 TCTAAGCATACCACTGCTTTTGG + Intergenic
1082836607 11:57655563-57655585 AGTGAGGATGGCACTGCTTGGGG + Intronic
1085678659 11:78549769-78549791 AATAAGGATGGCACTGGTTTTGG - Intronic
1085955975 11:81395572-81395594 AGTAATCATGCTAGTGGTTTGGG + Intergenic
1086109354 11:83182189-83182211 AGTAAACATTTCACTGCTTTTGG - Intronic
1091596413 12:1881886-1881908 AGTAAGCATGCCACTGCTTTTGG + Intronic
1093912282 12:24761790-24761812 ATTAACCCTGCCACTGCTTCGGG + Intergenic
1095491979 12:42744495-42744517 AGAGAGCATGCAACTGGTTTAGG - Intergenic
1095583292 12:43824543-43824565 AGCAAGCATGACAATGGTTTGGG - Intergenic
1098990027 12:77055733-77055755 ATTCAGTTTGCCACTGCTTTTGG + Intronic
1100011686 12:89961470-89961492 AGGATGCATGCCATTTCTTTTGG - Intergenic
1100047970 12:90407943-90407965 ATTAAGCTTGCCACTGTTGTTGG - Intergenic
1101626879 12:106452916-106452938 AATAAGCATGGCACTGCACTAGG + Intronic
1102019998 12:109675732-109675754 AATAATTAAGCCACTGCTTTTGG + Intergenic
1102875605 12:116446358-116446380 AGTATGCATGTGACTGCTATGGG - Intergenic
1104056819 12:125236985-125237007 AGTGAGCAGGTCACTGCTGTGGG + Intronic
1104399772 12:128465752-128465774 AGTAAGCATGCCACGCGTTAAGG + Intronic
1105656591 13:22447551-22447573 ACTGAGCTTGCCACTGTTTTGGG - Intergenic
1106276983 13:28219094-28219116 AGAGAACATGCCACTGTTTTCGG + Intronic
1106440747 13:29766340-29766362 AGTAAGCATGACACTGGATGTGG + Exonic
1107308721 13:39052854-39052876 ATTAACCATCACACTGCTTTTGG - Intergenic
1107372806 13:39771132-39771154 AGAAAGCCTGCCACTGCTTAGGG + Intronic
1109702455 13:66045193-66045215 CGTAGGACTGCCACTGCTTTTGG + Intergenic
1111048693 13:82849327-82849349 AATATGCATGCCATTGCTTTTGG - Intergenic
1112919985 13:104600588-104600610 AGTCAGCATCACACTGCTCTGGG + Intergenic
1113973229 13:114206810-114206832 AGGAAGAATCTCACTGCTTTTGG + Intergenic
1116447109 14:45022837-45022859 TGTAAGACTGCCACTTCTTTAGG + Intronic
1120276751 14:82385314-82385336 AATAAACATGGCATTGCTTTTGG - Intergenic
1124781980 15:32644682-32644704 ATTAACCATGCTACTTCTTTAGG - Intronic
1127591037 15:60423685-60423707 AGCAGGCAAGCAACTGCTTTTGG + Exonic
1130325193 15:82873956-82873978 AGTTAGCAGGCCTCTGCTGTGGG + Intronic
1130449648 15:84038036-84038058 AGCATGCATGCCACTGCACTTGG + Exonic
1131670968 15:94619251-94619273 AGTAGGAATGGCAGTGCTTTGGG + Intergenic
1140429394 16:74888680-74888702 AGGAAGAATCACACTGCTTTTGG + Intronic
1141707621 16:85676657-85676679 AGACAGCACCCCACTGCTTTTGG + Exonic
1143612055 17:8024376-8024398 AGTCCTCATGTCACTGCTTTTGG - Intergenic
1150896716 17:69220176-69220198 AGTAAAAATGTCACTTCTTTAGG - Intronic
1152046047 17:77936591-77936613 AGAAAACATGCCAGTGCATTTGG - Intergenic
1152972782 18:180543-180565 AGTGAGTACGACACTGCTTTTGG - Intronic
1153753162 18:8254176-8254198 AGAGAGCATGCCACTGTCTTGGG + Intronic
1154962335 18:21321915-21321937 ATTAAGCATGACGCTGGTTTGGG - Intronic
1155077590 18:22374198-22374220 AGTAAACATGCCAATTGTTTGGG + Intergenic
1157344157 18:46808506-46808528 ATTAAGCATTTCTCTGCTTTTGG - Exonic
1162571606 19:11477653-11477675 AGTACACAAGCCACTGCTTCTGG + Intronic
1164877886 19:31705491-31705513 AGTAAGCCTGGAACTGCTGTTGG - Intergenic
1167710024 19:51104764-51104786 TGTAAGGAAGCCACTGCCTTAGG + Intronic
927010861 2:18902772-18902794 AATAAGCATGCAACTTCTGTTGG - Intergenic
929166299 2:38885175-38885197 AGTCCCCCTGCCACTGCTTTTGG + Intronic
930167670 2:48219358-48219380 AGTAAGCAAGCCACTGGTTGGGG + Intergenic
930869487 2:56155454-56155476 AGTAGGCATGTGACTCCTTTTGG - Intergenic
932128020 2:69162206-69162228 AGGCAGGAAGCCACTGCTTTAGG - Intronic
934739936 2:96712919-96712941 ATGAGGCATGCCACTCCTTTGGG + Intronic
942508091 2:176665242-176665264 AGGAAGCATAACACTGCTCTGGG - Intergenic
943238320 2:185351098-185351120 AGAGAACATGCCACTGCATTTGG + Intergenic
945765654 2:213973592-213973614 AGTAAGAATGCCACAATTTTTGG + Intronic
946129125 2:217591904-217591926 TGTAAGACTGCCACTTCTTTAGG + Intronic
946809754 2:223511212-223511234 AGTAAGCAAGCAACCTCTTTTGG - Intergenic
947147493 2:227081520-227081542 AGTAGGAAAGCCACTACTTTTGG + Intronic
947570878 2:231233433-231233455 AGCTTGCATGCCACTGCTTTAGG + Intronic
1175120297 20:56711336-56711358 ACTAAGCAAGCCACTGCACTGGG + Intergenic
1175435937 20:58948216-58948238 AGTCCTCATGTCACTGCTTTTGG - Intergenic
1177312850 21:19419757-19419779 AGGAGGCATGTCAATGCTTTTGG - Intergenic
1177727197 21:24984997-24985019 AGAAAGCATTCCTCTGCTTGAGG - Intergenic
1178512142 21:33214427-33214449 AGTAAGAATGCCAAAGCTTTAGG - Intergenic
1180135298 21:45858464-45858486 AGTCAGCAGGACACTGCCTTAGG + Intronic
1184986072 22:48135964-48135986 ACTAAGCAATCCATTGCTTTGGG + Intergenic
949758335 3:7439516-7439538 AGTTAGCCTGCCACAGTTTTGGG - Intronic
949961816 3:9318463-9318485 AGCAAACATTCCACTGCTCTGGG - Intronic
952018253 3:28985538-28985560 ATTAAGCATGCCACTGTTACAGG + Intergenic
954325163 3:49859465-49859487 GGCCAGCATGGCACTGCTTTGGG + Exonic
955047275 3:55372196-55372218 AGTACCCATGCCAGTGCTTCTGG + Intergenic
957059307 3:75469140-75469162 AGGAATCATGCCTCTGCCTTCGG - Intergenic
958036184 3:88172821-88172843 GGTAAGAATGCCACTGCTTCTGG - Intergenic
958096381 3:88950855-88950877 AGCAGGCAAGCAACTGCTTTTGG - Intergenic
964363640 3:155925712-155925734 AGTAAGCATGCCAACCCTATAGG - Intronic
969003213 4:3999323-3999345 AGGAATCATGCCTCTGCCTTCGG - Intergenic
971745039 4:30568279-30568301 AGTAGGTATGCCACTGCCCTAGG - Intergenic
973992309 4:56421767-56421789 AGATATCATGCCACTGCTGTTGG - Intronic
977565578 4:98577216-98577238 AGTAGGGATGGCACTGCTTCTGG - Intronic
979913903 4:126405475-126405497 ATTAAGCAGCCCATTGCTTTAGG + Intergenic
981000166 4:139821580-139821602 AGTAAGCAAGGCCCTGCTGTGGG + Intronic
983044711 4:162972448-162972470 AGTCATCAAGCCATTGCTTTTGG + Intergenic
985290979 4:188387519-188387541 AGCAGGCAAGCAACTGCTTTTGG + Intergenic
986944258 5:12995527-12995549 AGTAAGCATGGGACTTCTTTTGG + Intergenic
988694339 5:33604999-33605021 AATAAGCATGTTACTGCCTTTGG + Intronic
991371346 5:65923952-65923974 ACTGATCAAGCCACTGCTTTAGG - Intergenic
992278144 5:75142759-75142781 GGTAAGCCTGCCATTGTTTTAGG + Intronic
993601697 5:89933711-89933733 AGGAAATATGCCACTGCTATAGG + Intergenic
995955667 5:117773403-117773425 AGACAGCACCCCACTGCTTTTGG - Intergenic
999629053 5:153551023-153551045 AGTAAGAAAACCACTGCTTTAGG + Intronic
999717225 5:154371061-154371083 AGACAGCATGGCACTGATTTTGG - Intronic
1001123056 5:168995925-168995947 AGAAAGAATACCAGTGCTTTGGG - Intronic
1003489872 6:6612336-6612358 AGTAAGCATTACACTTCTTAAGG + Intronic
1007524586 6:42480663-42480685 AGTGAGCAGGCTACTGCTGTGGG - Intergenic
1007918453 6:45584640-45584662 AGCCCCCATGCCACTGCTTTTGG - Intronic
1008404013 6:51098927-51098949 AGAAAGCAAGGCTCTGCTTTTGG - Intergenic
1010154237 6:72773944-72773966 AGTAAGCATGGGTCTGCTTCTGG - Intronic
1011584362 6:88908773-88908795 AGTAAGACTGCCACTGCCATAGG + Intronic
1012927107 6:105278689-105278711 AGTAAGCATGCCTGTGATTTGGG - Intronic
1014503477 6:122223716-122223738 AAACAGCATGCTACTGCTTTAGG - Intergenic
1020322168 7:6947427-6947449 AGGAATCATGCCTCTGCCTTCGG - Intergenic
1021208560 7:17814808-17814830 AGTAAGCAGACCACTGCACTGGG - Intronic
1023244317 7:38184407-38184429 AGGAAGCATGGCTCGGCTTTTGG + Intronic
1023887948 7:44374403-44374425 AGGAAGCCTGCCAGTGCCTTTGG + Intergenic
1030741701 7:113117527-113117549 AGTCCTCATGTCACTGCTTTTGG - Exonic
1031006320 7:116476646-116476668 AGCATGCATGGCACAGCTTTTGG - Intronic
1031021030 7:116627602-116627624 AATAAGCATGCCCCTCCTTCTGG + Intergenic
1031112124 7:117623690-117623712 AGTAAGAATGACAGTGCTGTAGG - Intronic
1034782714 7:153895570-153895592 AGCAAGCATGCCACTGTATACGG + Intronic
1039133181 8:34291172-34291194 AGTGGCCCTGCCACTGCTTTGGG + Intergenic
1042056242 8:64767286-64767308 TGTAAGACTGCCACTTCTTTAGG - Intronic
1046510304 8:115193952-115193974 AGCAAGCATGGCACAGATTTAGG + Intergenic
1049523528 8:143108017-143108039 AGTAAGCATGGCACTGGCATTGG - Intergenic
1050262210 9:3852404-3852426 AGCAACCCTGACACTGCTTTGGG + Intronic
1051813827 9:21080995-21081017 AGTGATCATACCACTTCTTTAGG - Intergenic
1051935662 9:22439898-22439920 TGTAAGACTGCCACTTCTTTGGG - Intergenic
1051952156 9:22648790-22648812 AGTATGAAAGCCACTGCTTTGGG - Intergenic
1055113517 9:72583603-72583625 AGAAAACATGCCATTGCTTGAGG - Intronic
1055719981 9:79162399-79162421 AGTTAGCAAGCCACAGCTTCCGG + Intergenic
1056140202 9:83670519-83670541 ATTAAGTATGCCACAGCCTTCGG + Intronic
1059459999 9:114423594-114423616 AGTTTGCATGCCAGTCCTTTGGG - Intronic
1060870554 9:127036520-127036542 AGTAAGCATCCAAATGTTTTGGG + Intronic
1062685991 9:137813765-137813787 AAGATGCCTGCCACTGCTTTGGG - Intronic
1187745309 X:22403036-22403058 AATAAGCATGTTACTGCTGTGGG + Intergenic
1187829386 X:23365535-23365557 ATTAAGCAGGCCACTTCTGTGGG + Intronic
1188122293 X:26322590-26322612 AATAAGCATGGTACTGCATTAGG + Intergenic
1189238279 X:39505704-39505726 AACAAGCATGCCAGTGCTATTGG - Intergenic
1192336103 X:70221202-70221224 AGTAAGCAAGCCACACCATTAGG + Intergenic
1192946500 X:75969316-75969338 AGTGAGCAGGCCACAGCTGTTGG - Intergenic
1194099489 X:89686119-89686141 ACTAAGCATGCAGCTTCTTTGGG - Intergenic
1196774969 X:119329951-119329973 AGTCAGCATGAAACAGCTTTAGG + Intergenic
1199739035 X:150715192-150715214 AGTTTGAAAGCCACTGCTTTTGG + Intronic