ID: 1091596953

View in Genome Browser
Species Human (GRCh38)
Location 12:1884740-1884762
Sequence TCTCCCTGGACACCCGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091596947_1091596953 6 Left 1091596947 12:1884711-1884733 CCCATCCATGGCAGCAGGAGAAG 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1091596944_1091596953 18 Left 1091596944 12:1884699-1884721 CCTGCTGGTGATCCCATCCATGG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1091596949_1091596953 1 Left 1091596949 12:1884716-1884738 CCATGGCAGCAGGAGAAGCTTTT 0: 1
1: 1
2: 0
3: 17
4: 222
Right 1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1091596943_1091596953 19 Left 1091596943 12:1884698-1884720 CCCTGCTGGTGATCCCATCCATG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1091596942_1091596953 30 Left 1091596942 12:1884687-1884709 CCTTCTAGGGTCCCTGCTGGTGA 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1091596948_1091596953 5 Left 1091596948 12:1884712-1884734 CCATCCATGGCAGCAGGAGAAGC 0: 1
1: 0
2: 1
3: 36
4: 305
Right 1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091596953 Original CRISPR TCTCCCTGGACACCCGTGGG AGG Intronic
900157815 1:1210659-1210681 TCCCCCTGGACACCTATGGCAGG + Intergenic
900878338 1:5362249-5362271 TAGCCCTGGACAACCATGGGAGG - Intergenic
901764014 1:11488505-11488527 TCCACCTGGGCACCCGTGGTGGG + Intronic
901934652 1:12619040-12619062 TCTCCCTGGACTGCCCTGGCGGG + Intergenic
904786241 1:32985127-32985149 TTTCCCTGGACACCCATCAGAGG + Intergenic
905891529 1:41521400-41521422 CCTCCCTGCACCCCCGTGGCGGG - Intronic
915325057 1:155077597-155077619 TCTCCCTGGACACAGGTGGTTGG + Intergenic
915339792 1:155170596-155170618 GCTCCCTGGACACAGGTTGGAGG + Intronic
917451421 1:175150821-175150843 TCTCCCTTGGCACCCCTGGCAGG - Intergenic
919974947 1:202604278-202604300 TCTACCTGGAGGCCCCTGGGAGG - Intronic
924003934 1:239586091-239586113 ACTCCCTGCCCTCCCGTGGGAGG + Intronic
924443040 1:244102740-244102762 TCTCCCTAGGCACCCCTGGACGG + Intergenic
1066526388 10:36283972-36283994 TCTCCCTGGACCCATGTGGGAGG - Intergenic
1069682077 10:70292368-70292390 ACTCCCTGCACATCCTTGGGTGG + Intergenic
1069688604 10:70335042-70335064 TCTCCGAGGTCACCCCTGGGAGG + Intronic
1070899267 10:80013865-80013887 TCTCCCTGCACACCCTGGGTAGG + Intergenic
1074914146 10:117939426-117939448 TCTCCCTGGACCTCCCTGGTTGG - Intergenic
1074945651 10:118278354-118278376 TCTCTCTGCATACCTGTGGGTGG - Intergenic
1076619826 10:131780027-131780049 CCTCCCTGGACATCCTTGTGGGG - Intergenic
1077263552 11:1636717-1636739 TCTCCCTGGGCTCCTCTGGGCGG - Intergenic
1077465702 11:2732817-2732839 CCTCCCTGGGCCCCAGTGGGTGG - Intronic
1077468640 11:2746468-2746490 TCTCCCTGGGCTCCTCTGGGCGG + Intronic
1077489652 11:2854990-2855012 TCTCCCAGAACAGCCGAGGGAGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083749164 11:64751916-64751938 TCACCCTGTACAACCGTGAGTGG - Exonic
1084735007 11:71099178-71099200 TCTCCCTGGGCACCTCTTGGTGG - Intronic
1084763161 11:71287021-71287043 CCTTCCAGGACAGCCGTGGGAGG - Intergenic
1085530718 11:77190533-77190555 GCTCCCTGGACACCTGTGACAGG + Intronic
1088285381 11:108182318-108182340 TCTCCCTGCACACCCTGGGTAGG + Intronic
1089492816 11:118894380-118894402 TCTTCCTGGACACCCTGGCGAGG + Exonic
1090585031 11:128202090-128202112 TCTCCATGGCCAGCCGTGTGGGG - Intergenic
1091252097 11:134152915-134152937 CCTGCCTGGACACTGGTGGGAGG + Exonic
1091396198 12:155521-155543 TCTCCCCAGAAACCTGTGGGAGG + Intronic
1091449906 12:565899-565921 TCTGCCTCGGCACCCGTGGCTGG - Intronic
1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG + Intronic
1091761673 12:3091561-3091583 TCTCCCTGGAGATCCGAGGCTGG + Intronic
1094826724 12:34275287-34275309 ACTCCAGGGACACCCTTGGGAGG + Intergenic
1102508156 12:113397126-113397148 GCTTGCTGGACACCCGAGGGAGG + Intronic
1103483030 12:121263723-121263745 TCTCCCTGGAAACCAGTGGCGGG + Intronic
1103716805 12:122949815-122949837 TCTCCTGGGACACCAGTGAGCGG + Exonic
1104047263 12:125172189-125172211 TCTCCCTGTAGACCCCTGAGTGG + Intergenic
1107459342 13:40586417-40586439 TCTCCCTGGAAACCCGGGGATGG - Intronic
1113007950 13:105729046-105729068 CCTACCTGGACAGCAGTGGGTGG - Intergenic
1113385852 13:109847054-109847076 TTTTCCTGCACACCCATGGGAGG - Intergenic
1113484912 13:110646580-110646602 CTGCCCAGGACACCCGTGGGTGG + Intronic
1113955427 13:114097928-114097950 TCTCCCTGGACCCCCTGTGGTGG - Intronic
1116799696 14:49429711-49429733 TCTGCCTGGTCACCAGTGGTGGG - Intergenic
1116996609 14:51331471-51331493 GCTCACTGGACACCCTTGGAGGG + Intergenic
1122671241 14:103374328-103374350 TTCCCGTGAACACCCGTGGGAGG - Intergenic
1130641134 15:85676501-85676523 TCTCCCTGCTCACCTGTGGGTGG - Intronic
1132236889 15:100228834-100228856 TCTCCCTGCCTACCTGTGGGAGG + Intronic
1132354219 15:101159352-101159374 TCCCCATGGACACCCGGAGGCGG + Intergenic
1132645447 16:997363-997385 TCTCCCTGGGCCCCCGAGGGAGG + Intergenic
1132748973 16:1448653-1448675 GCGCCCAGGACACCTGTGGGTGG - Intronic
1133184502 16:4085875-4085897 CATCCCTGGACACGCATGGGTGG - Intronic
1134069819 16:11254246-11254268 TCTCCCTGGAGAGTTGTGGGTGG + Intronic
1141576125 16:84964441-84964463 CCTCCCTGGTCACCCCTGGCAGG - Intergenic
1141829194 16:86500314-86500336 TCTCCCTGAACACCCAGGGAGGG + Intergenic
1146644145 17:34565384-34565406 TCTCCCTGGAGAACTCTGGGTGG + Intergenic
1151407491 17:73898690-73898712 TGACCCTGAACCCCCGTGGGTGG - Intergenic
1152110380 17:78354462-78354484 TCTCCCTGCCCACCCCAGGGAGG - Intergenic
1152659169 17:81534538-81534560 TCTCCCAGGACCCCTGGGGGAGG - Intronic
1161383765 19:3980279-3980301 TGTCCCTGGGCACAGGTGGGTGG - Intronic
1162744936 19:12792868-12792890 GCTCCCTGGACCCCAGTGGGAGG - Exonic
1162913475 19:13862290-13862312 TCTGCCTGGACACCCCAGGCTGG - Intronic
1164386901 19:27779372-27779394 TCTCCCTGGTCTCACCTGGGTGG + Intergenic
1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG + Intronic
1167645312 19:50702576-50702598 GCTCCCTGGGCAGCCGCGGGAGG - Exonic
926322096 2:11755629-11755651 TATACCTGGACAGCCGGGGGAGG + Intronic
927720704 2:25380047-25380069 TCTCCCTGTTCACCCCTGGCTGG - Intronic
932485323 2:72081046-72081068 GGTCCCTGGACAGCCATGGGTGG - Intergenic
933737112 2:85504099-85504121 GCTCCCTGGACACCTGTGCTGGG - Intergenic
934619880 2:95797523-95797545 TCTCCCTGGACAGCTCTGAGGGG + Intergenic
934641008 2:96027034-96027056 TCTCCCTGGACAGCTCTGAGGGG - Exonic
943378830 2:187117645-187117667 TCTCCATGGGCTCCAGTGGGTGG + Intergenic
948489541 2:238303675-238303697 GCTCCCTGCAGACCTGTGGGCGG + Intergenic
1168994516 20:2123060-2123082 TCTCCCTGGTAACACGTGGGCGG - Intronic
1174192365 20:48749437-48749459 TCTCCCTAGACAAGCGTGGTGGG - Intronic
1174610428 20:51793756-51793778 CCCTCCTGGAAACCCGTGGGTGG - Intronic
1175826441 20:61938885-61938907 CCTCCCTGGGCAGCCATGGGAGG - Exonic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1179275862 21:39891245-39891267 TCTCTGAGGACCCCCGTGGGTGG + Intronic
1179916895 21:44483525-44483547 CCTCCCTCGGCACCAGTGGGAGG + Intergenic
1180726578 22:17951012-17951034 TCTCCCGGAAGACCCGTGGTAGG - Intronic
1182099943 22:27650746-27650768 GCTGCCTGGTCCCCCGTGGGAGG - Intergenic
1182418550 22:30237036-30237058 TCTCCCTGGAGACTTATGGGGGG - Intergenic
1182546608 22:31080488-31080510 TCTCCATGGAGACCCAAGGGCGG + Intronic
1183718048 22:39545788-39545810 TCTCCCTGAAAACCCCTGGCAGG + Intergenic
1184131316 22:42518341-42518363 TCTCCCTGCACCGCCTTGGGAGG - Intronic
1184141538 22:42580553-42580575 TCTCCCTGCACCGCCTTGGGAGG - Intergenic
1184842977 22:47063390-47063412 TCGTCCTGGAGCCCCGTGGGTGG + Intronic
1184845112 22:47078119-47078141 TCCCCCTAGACACCCTTGAGGGG + Intronic
1185211540 22:49573355-49573377 TCTCTCTGGAGCCCGGTGGGAGG + Intronic
949418258 3:3836781-3836803 TCTCCCTAGACTACAGTGGGTGG + Intronic
950627882 3:14261433-14261455 CTTCCCTGGAGACCCATGGGTGG + Intergenic
954236433 3:49260691-49260713 TTTCCCGGGACACCTGTGGCAGG + Intergenic
955139537 3:56255513-56255535 TCTCCCTGGGCTGCCCTGGGAGG + Intronic
955585861 3:60476825-60476847 TCGTCCTGGACACCCGGGGAAGG + Intronic
956168729 3:66416110-66416132 TCTCCCTGCACAAAAGTGGGAGG - Intronic
969333648 4:6494329-6494351 TTCCCCTGGACACCCCGGGGAGG - Intronic
969663110 4:8541859-8541881 TCTCACTGGACATCCGGGTGTGG + Intergenic
973606619 4:52593515-52593537 TCACCCAGGGCACCTGTGGGTGG - Exonic
983301599 4:165933340-165933362 TCTCTCTGGCCTCCCCTGGGAGG + Intronic
986540513 5:8839985-8840007 TCTCCCTGGACACAGGTCTGTGG - Intergenic
989732525 5:44664994-44665016 GCTCCCTGGACACCCAAAGGGGG - Intergenic
999285401 5:150391534-150391556 TCTTCTTTGACACCTGTGGGTGG - Exonic
1001154612 5:169262338-169262360 TCTTCCTGGACACCCTAGGGAGG - Intronic
1005734463 6:28732583-28732605 TTCCCGTGAACACCCGTGGGAGG + Intergenic
1006059770 6:31411416-31411438 TTTCCCTGGACACATCTGGGAGG - Intronic
1006451291 6:34107171-34107193 TGTCCAAGGACAGCCGTGGGAGG - Intronic
1006581796 6:35081662-35081684 TCTGCCTGCAGCCCCGTGGGGGG + Intronic
1007721205 6:43886388-43886410 TCTGCCTGGCCACCCCAGGGAGG + Intergenic
1007756257 6:44101636-44101658 TCTGCATGGAGACCCCTGGGGGG - Intergenic
1010786222 6:80004432-80004454 GTTCCCCGGACGCCCGTGGGCGG - Intronic
1011936377 6:92783508-92783530 TATCCCTGGAAACCAGTGAGCGG - Intergenic
1014136829 6:117898905-117898927 TCTCCATGGACAGGGGTGGGCGG - Intergenic
1019476827 7:1248384-1248406 GGTCCCTGGACACCAGTGGGTGG - Intergenic
1032127462 7:129205405-129205427 TCACCCTGGTCAGCCGCGGGAGG + Exonic
1034459169 7:151188394-151188416 TCTCCCTGGATGACCTTGGGTGG + Intergenic
1034935791 7:155199838-155199860 TCTCCCTAGACCTCCGTGTGAGG + Intergenic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1043470699 8:80559436-80559458 TTCCCGTGAACACCCGTGGGAGG + Intergenic
1043734999 8:83730875-83730897 TGTCCATGGACAGCCATGGGCGG + Intergenic
1047835010 8:128679911-128679933 TCTCCCTGGACACCCTTCTTGGG + Intergenic
1049418537 8:142506429-142506451 TCACCCTGGACACATGGGGGTGG + Intronic
1050694551 9:8263876-8263898 ACTCACTAGACACCCATGGGAGG - Intergenic
1053510803 9:38686556-38686578 CCTCCCTGGACACCTGTGCCTGG + Intergenic
1053616826 9:39775823-39775845 GGTCCCTTGACACCAGTGGGTGG - Intergenic
1054236691 9:62566560-62566582 GGTCCCTTGACACCAGTGGGTGG + Intergenic
1054267342 9:62931615-62931637 GGTCCCTTGACACCAGTGGGTGG + Intergenic
1054550828 9:66601068-66601090 GGTCCCTTGACACCAGTGGGTGG + Intergenic
1059404138 9:114089540-114089562 TCACGCTGGCCACCTGTGGGAGG - Intronic
1059898005 9:118890111-118890133 TCTTCTTGGACAGGCGTGGGAGG + Intergenic
1060488105 9:124062406-124062428 TCTCCCAGGCCACAAGTGGGCGG + Intergenic
1061037536 9:128121988-128122010 TCTCCCAGAAAACCCCTGGGAGG - Intronic
1062511446 9:136908351-136908373 TTTCCCTGGAGACACGCGGGCGG + Intronic
1188261773 X:28032297-28032319 GATCCCTGGACACCCCTGTGAGG + Intergenic
1189806612 X:44741643-44741665 TTCCCGTGGACACCCATGGGAGG + Intergenic
1192776318 X:74249221-74249243 TCTCCCTGGGCTCTGGTGGGTGG - Intergenic
1196814689 X:119655420-119655442 GCTCACTGGACTCCAGTGGGTGG + Intronic
1200084055 X:153594292-153594314 TCTGCCTGCTCACCTGTGGGCGG - Intronic
1200256772 X:154586451-154586473 TCTCCCTGGGCTCCCTCGGGTGG - Intronic
1200260997 X:154617952-154617974 TCTCCCTGGGCTCCCTCGGGTGG + Intronic
1200267039 X:154652320-154652342 TCTCCCTGGGCTCCCTCGGGTGG + Exonic
1200860156 Y:7982807-7982829 GCTGCCTTGACACCCATGGGTGG + Intergenic
1202259097 Y:22950798-22950820 GCTGCCTCGACACCCATGGGAGG - Intergenic
1202412083 Y:24584542-24584564 GCTGCCTCGACACCCATGGGAGG - Intergenic
1202458697 Y:25085526-25085548 GCTGCCTCGACACCCATGGGAGG + Intergenic