ID: 1091599356

View in Genome Browser
Species Human (GRCh38)
Location 12:1908599-1908621
Sequence TGTCCGTGACGCAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091599356_1091599365 13 Left 1091599356 12:1908599-1908621 CCCCCAGGACTGCGTCACGGACA 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1091599365 12:1908635-1908657 TCCCACGCCGGACTGCCTCACGG 0: 2
1: 4
2: 0
3: 6
4: 61
1091599356_1091599361 1 Left 1091599356 12:1908599-1908621 CCCCCAGGACTGCGTCACGGACA 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1091599361 12:1908623-1908645 CCCCACGCCAACTCCCACGCCGG 0: 7
1: 0
2: 2
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091599356 Original CRISPR TGTCCGTGACGCAGTCCTGG GGG (reversed) Intronic
901076445 1:6557898-6557920 TGTCCCTGGCTCATTCCTGGTGG + Intronic
901475526 1:9486695-9486717 TGGCTGTGGCACAGTCCTGGGGG - Intergenic
906713856 1:47952563-47952585 TGTCAGGGAAGGAGTCCTGGAGG - Intronic
907519247 1:55012320-55012342 AGTCCGTGAAACAGCCCTGGGGG + Intergenic
911055968 1:93708828-93708850 TGTCCTTGGCACAGCCCTGGCGG - Intronic
916231053 1:162541722-162541744 TGCTCGTGACGCAATCCTTGGGG - Intergenic
1063196695 10:3750017-3750039 TGGCCCTGACACAGTCCTTGGGG + Intergenic
1068202927 10:53806938-53806960 TGTCCGTGAGGCAGGCACGGCGG + Intronic
1083224073 11:61273667-61273689 TGCCCCTGACTCAGTCCTGAAGG - Intronic
1084328162 11:68413837-68413859 TGTCCATCACGAAGTCCAGGTGG - Exonic
1086432225 11:86746975-86746997 TGTCCAAGAAGCAGTGCTGGTGG - Intergenic
1091599356 12:1908599-1908621 TGTCCGTGACGCAGTCCTGGGGG - Intronic
1092056473 12:5512110-5512132 TGTCCAGAACACAGTCCTGGAGG - Intronic
1101839468 12:108317419-108317441 TGACCGTGATGCACTCCTGGTGG - Intronic
1118286545 14:64479508-64479530 TGTCCGTGAGGGTGTTCTGGAGG + Exonic
1118400365 14:65373900-65373922 TGTCCGTGCCCCACTCCTGCAGG - Intergenic
1119906828 14:78312704-78312726 CGTCCGTGAGGCAGCCTTGGGGG + Intronic
1124206374 15:27724336-27724358 TGTAGGTGAGGCACTCCTGGTGG + Intergenic
1127836136 15:62792715-62792737 TGTCTGTGGGGCAGACCTGGAGG - Exonic
1131871989 15:96772955-96772977 TGTCCATGTCACAGACCTGGAGG - Intergenic
1132206967 15:99993001-99993023 TCTCCGTGCCGCAGTGCAGGGGG - Intronic
1132671679 16:1104498-1104520 TGTCCGTGAAGCAGCCCCGTAGG - Intergenic
1132870002 16:2111749-2111771 TGTGAGTGACGGCGTCCTGGTGG - Exonic
1133731131 16:8579473-8579495 TGTCCTTGAGTCTGTCCTGGAGG + Intronic
1134717421 16:16363852-16363874 TGTGAGTGACGGCGTCCTGGTGG + Intergenic
1134957331 16:18388307-18388329 TGTGAGTGACGGCGTCCTGGTGG - Intergenic
1136627542 16:31471529-31471551 TGTCCATGACCAAGTCTTGGAGG + Intergenic
1138533410 16:57647093-57647115 TGTGCGTGGGGCAGACCTGGAGG + Intronic
1139552855 16:67685302-67685324 TGTCCCTGAAGCAGTGCTTGGGG - Intronic
1141512645 16:84522709-84522731 TGTCCCTGACCCAGGCTTGGAGG + Intronic
1143011799 17:3870063-3870085 TGTCTGTGCCTCTGTCCTGGAGG - Intronic
1149645327 17:58236850-58236872 TGGCCGTGAAGCACACCTGGAGG - Intronic
1152361543 17:79835335-79835357 TGTCAGTGGAGGAGTCCTGGAGG + Exonic
1152923206 17:83076173-83076195 TGTCTGTGACCCAGAGCTGGGGG + Intergenic
1156462613 18:37329862-37329884 TGCCCATGACGCTGACCTGGGGG + Intronic
1158131155 18:54153793-54153815 TTTCCTTGAAGCAGTCCTGCTGG - Exonic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160584697 18:79905748-79905770 TGTCCCTGAAGCAGGCGTGGTGG - Intronic
1160839367 19:1138759-1138781 TGTCCGTGATGGAGGCGTGGAGG - Intronic
1160839376 19:1138795-1138817 TGTCCGTGATGGAGGCGTGGAGG - Intronic
1160839382 19:1138830-1138852 TGTCCGTGATGGAGGCGTGGAGG - Intronic
1162997092 19:14343074-14343096 TCTCCCTGGCCCAGTCCTGGGGG - Intergenic
1163245083 19:16088487-16088509 TGGCCGTGACACATTCCTGGCGG + Intronic
1163604212 19:18265302-18265324 TGACCAAGACGCAGTCCCGGGGG - Exonic
934090879 2:88549670-88549692 TGTCCGGGACGCAGACCTGCTGG - Intergenic
935409672 2:102747743-102747765 TGTCTGTGACAGAGTTCTGGTGG + Intronic
936573583 2:113635590-113635612 TGCCCGGGACGCAGTCCTCACGG + Intronic
944908063 2:204282510-204282532 TCTCCCTGACTCAGTTCTGGGGG - Intergenic
1170433000 20:16294449-16294471 TGTGGGTGACTCAGTCCTGCTGG + Intronic
1172284506 20:33731630-33731652 GGTCCGTGCAGCAGACCTGGAGG + Intergenic
1175482637 20:59322239-59322261 TGCCTGAGACGCAGTCCTTGGGG + Intronic
1176839632 21:13828058-13828080 TGTCCCTGCCCCATTCCTGGGGG - Intergenic
1180184404 21:46132330-46132352 TGCCCGTGACGCCGTCCGTGAGG - Exonic
1182350745 22:29698044-29698066 TGTCCGTGAGGCTGTCCTTTTGG + Exonic
1185248368 22:49785585-49785607 TGTCCTTGACTCAGGACTGGGGG - Intronic
952834340 3:37590925-37590947 TGTCCTTAGCGCAGCCCTGGGGG + Intronic
954456480 3:50602430-50602452 TGTGGGTGAGACAGTCCTGGAGG + Intergenic
968047168 3:195630945-195630967 CCTCCGTGACCCAGCCCTGGAGG + Intergenic
968307479 3:197659099-197659121 CCTCCGTGACCCAGCCCTGGAGG - Intergenic
989817751 5:45756861-45756883 TTTCCGTGCCCCAGTCATGGGGG - Intergenic
992766065 5:80001597-80001619 TGTCAGTGAAGCACTCCTGGAGG + Intronic
1004523762 6:16386623-16386645 TGTCAGAGACCCAGCCCTGGTGG - Intronic
1004818095 6:19334101-19334123 TGTCAGTGACTCAGTCAAGGAGG - Intergenic
1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG + Intergenic
1019463957 7:1176234-1176256 TGTCCCGGAAGCTGTCCTGGCGG - Intergenic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1051262036 9:15273876-15273898 AGTCCCTGCCTCAGTCCTGGGGG - Intronic
1054913961 9:70479058-70479080 TGTCCCTGACTAAGTCCTTGAGG + Intergenic
1056965058 9:91158614-91158636 TGTCTGTGACTCATGCCTGGCGG - Intergenic
1057139578 9:92718425-92718447 TGGTGGTGACGCAGGCCTGGGGG + Intronic
1190872449 X:54435594-54435616 GGTCCCTGACCCAGCCCTGGGGG - Intergenic