ID: 1091600000

View in Genome Browser
Species Human (GRCh38)
Location 12:1912350-1912372
Sequence GTGTCTGCACTGAGGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091600000_1091600011 26 Left 1091600000 12:1912350-1912372 CCCATAGGCCTCAGTGCAGACAC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1091600011 12:1912399-1912421 TGTTTCTCCTGGGCCCCACCAGG 0: 1
1: 0
2: 1
3: 20
4: 229
1091600000_1091600010 16 Left 1091600000 12:1912350-1912372 CCCATAGGCCTCAGTGCAGACAC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1091600010 12:1912389-1912411 GGAAAGCTTCTGTTTCTCCTGGG 0: 1
1: 0
2: 2
3: 31
4: 288
1091600000_1091600009 15 Left 1091600000 12:1912350-1912372 CCCATAGGCCTCAGTGCAGACAC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1091600009 12:1912388-1912410 GGGAAAGCTTCTGTTTCTCCTGG 0: 1
1: 0
2: 0
3: 18
4: 330
1091600000_1091600003 -7 Left 1091600000 12:1912350-1912372 CCCATAGGCCTCAGTGCAGACAC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1091600003 12:1912366-1912388 CAGACACTTCACCCCAGAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 213
1091600000_1091600005 -5 Left 1091600000 12:1912350-1912372 CCCATAGGCCTCAGTGCAGACAC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1091600005 12:1912368-1912390 GACACTTCACCCCAGAGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 173
1091600000_1091600004 -6 Left 1091600000 12:1912350-1912372 CCCATAGGCCTCAGTGCAGACAC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1091600004 12:1912367-1912389 AGACACTTCACCCCAGAGAAGGG 0: 1
1: 0
2: 2
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091600000 Original CRISPR GTGTCTGCACTGAGGCCTAT GGG (reversed) Intronic
901202289 1:7473560-7473582 ATGCCTGGGCTGAGGCCTATAGG - Intronic
901799227 1:11697824-11697846 CTGGCTGCTCTGAGGCCTAGGGG + Intronic
902441121 1:16430714-16430736 GTGGCTCCACTGAGCCCCATGGG - Intronic
903063169 1:20684273-20684295 GTGTTTGAACTGTGGCCTCTGGG + Intronic
904322858 1:29708053-29708075 GTGTCTGCGCTGAGACCTGAAGG - Intergenic
905538610 1:38742757-38742779 GTGACTGTGCTGAGGCCCATGGG - Intergenic
906149437 1:43578987-43579009 GTGTCTGCACCAAGGGCTCTGGG - Intronic
910576363 1:88769094-88769116 GTGTCTGAAGCGAGGCCTACTGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
919264145 1:195238640-195238662 GTGGGTGCAATGAGGCCAATGGG + Intergenic
920142091 1:203823667-203823689 TTTTCTGCACTGAGGCTTATTGG + Intronic
1063683035 10:8208728-8208750 TTGTTTGAACTGAAGCCTATTGG - Intergenic
1066792391 10:39080370-39080392 GAGACTCCATTGAGGCCTATGGG + Intergenic
1066815546 10:39405456-39405478 GTGACCCCATTGAGGCCTATGGG + Intergenic
1066929270 10:41736363-41736385 GGGTGTCCACTGAGGCCTATGGG + Intergenic
1069664293 10:70144754-70144776 GTGTCCCCACTGTGGCCTATAGG - Intronic
1071003355 10:80855771-80855793 GAGTATGCACTGATGCTTATAGG - Intergenic
1071426814 10:85565518-85565540 GTGTCTTCACTGAGTGCTCTTGG + Intergenic
1076041100 10:127249631-127249653 GTGACTGCACTGAATACTATAGG + Intronic
1076739600 10:132476740-132476762 ATGTCTGCACTGAGGTCTTTGGG + Intergenic
1078329413 11:10407479-10407501 GTGACTGCAGTGGGGCATATGGG + Intronic
1079970940 11:27034064-27034086 GTGTCTGCAGTGACACCCATGGG + Intergenic
1079983668 11:27178073-27178095 CATTCTGCACTGAGGGCTATTGG + Intergenic
1080216472 11:29847591-29847613 GTGTCTGAAATTAGGCCTACTGG - Intergenic
1081585226 11:44379716-44379738 GTGTCTGCTCTGTGCCCTTTTGG + Intergenic
1089880388 11:121767850-121767872 CTCTCTGCAGTGAGGCCTTTGGG - Intergenic
1091600000 12:1912350-1912372 GTGTCTGCACTGAGGCCTATGGG - Intronic
1092506567 12:9107661-9107683 GTGTCTGCTCTGATTCCTTTGGG - Intronic
1095081190 12:38001557-38001579 GGGAGTCCACTGAGGCCTATGGG + Intergenic
1095800095 12:46263051-46263073 CTGTTAGAACTGAGGCCTATTGG - Intronic
1096055016 12:48643289-48643311 GTGACTGCACTGAATACTATAGG + Intergenic
1102459669 12:113092919-113092941 GTGTCTGCACTAAAGTCTAAGGG + Intronic
1103393655 12:120591701-120591723 GTGTCTGAGCTGAGGCCTGAAGG + Intergenic
1103987428 12:124777361-124777383 GCGTCTGCACTGGGGGCTGTGGG + Intronic
1105345171 13:19564921-19564943 GTGTCTGCGGCGAGGCCTCTAGG - Intergenic
1108041138 13:46340214-46340236 GTGTCTGTGCTGTGGCCTTTTGG - Intergenic
1111102595 13:83606973-83606995 ATGTCAGCAATGAGGCCTAGAGG + Intergenic
1114907982 14:27153883-27153905 GTGTCTTCATTAAGGCCCATGGG - Intergenic
1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG + Intronic
1121981835 14:98461151-98461173 GTGTTAGCAGTGAGGCCTAGTGG + Intergenic
1123228768 15:17080021-17080043 GTGAGTGCTTTGAGGCCTATGGG - Intergenic
1123967184 15:25470809-25470831 TTGTCTTCAGTGAGGACTATTGG + Intergenic
1124966243 15:34435210-34435232 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1124982845 15:34581293-34581315 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1134165351 16:11925346-11925368 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1134489952 16:14689096-14689118 GTGCCTGGGCTGAGGCCTAAGGG - Intronic
1134495333 16:14728213-14728235 GTGCCTGGGCTGAGGCCTAAGGG - Intronic
1134500721 16:14767336-14767358 GTGCCTGGGCTGAGGCCTAAGGG - Intronic
1134527258 16:14953941-14953963 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1134545141 16:15102396-15102418 GTGCCTGGGCTGAGGCCTAAGGG + Intronic
1134579861 16:15361713-15361735 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1134714847 16:16352485-16352507 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1134722724 16:16395847-16395869 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1134944704 16:18316024-18316046 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1134951968 16:18356174-18356196 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1135310310 16:21400242-21400264 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1135363258 16:21832659-21832681 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1135448532 16:22538401-22538423 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1135616001 16:23911720-23911742 GTGGCTGCACTGAGGCTCCTGGG - Intronic
1136149895 16:28340576-28340598 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1136166129 16:28454380-28454402 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1136196842 16:28660640-28660662 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1136213182 16:28774763-28774785 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1136257913 16:29054680-29054702 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1136307056 16:29379386-29379408 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1136320580 16:29481629-29481651 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1138280018 16:55765519-55765541 GGGTCTGCTCTGATGCCTGTAGG - Intergenic
1139855184 16:69974367-69974389 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1139884902 16:70201500-70201522 GTGCCTGGGCTGAGGCCTAAGGG + Intergenic
1140367615 16:74394025-74394047 GTGCCTGGGCTGAGGCCTAAGGG - Intergenic
1141699451 16:85635775-85635797 GTGTCTGCTTTGGGGCCTCTGGG + Intronic
1142315976 16:89345319-89345341 GTGTCGGCACTGAGCTCTGTGGG - Intronic
1142721833 17:1781366-1781388 GTCGCTGCACTGTGGCCCATGGG - Exonic
1142819648 17:2455566-2455588 GTGTCTGCTCTGAGGTCTCAGGG - Intronic
1143726209 17:8848511-8848533 GTGACTGCACTGAGTACTGTAGG + Intronic
1146946840 17:36879046-36879068 GTGTCTGGACTGGAGTCTATCGG + Intergenic
1147332029 17:39704957-39704979 GTGTGTGCAGTTAGGCCTAGTGG + Intronic
1149637601 17:58183369-58183391 GAGTCTGCTCTGGGGACTATAGG + Intergenic
1161166006 19:2787870-2787892 CTGTCTGCACTGTGGCCATTGGG - Intronic
1163344177 19:16729422-16729444 GTGTTTGCACTGAGACCCAAAGG - Intronic
1163552360 19:17972675-17972697 GCTCCTGCACTGTGGCCTATGGG - Intronic
1164353684 19:27389076-27389098 GTGAGTGCATTGAGGCCTATGGG + Intergenic
1164353715 19:27389587-27389609 GTGACTGCATTGAGGCCTATGGG + Intergenic
1165284587 19:34831478-34831500 GGGTCAGCACTGCAGCCTATGGG - Intergenic
1167567366 19:50265112-50265134 GTTGCTGCACTGCGGCCTGTGGG + Intronic
925043090 2:748876-748898 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925043098 2:748951-748973 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
926061170 2:9806085-9806107 CTGTTAGCACTGAGGCCTGTGGG - Intergenic
926757120 2:16245121-16245143 CTCTCTGGACTGCGGCCTATGGG - Intergenic
927939724 2:27095952-27095974 GTGCCTGGACTGAGGCCAGTGGG - Intronic
931462721 2:62462442-62462464 CTGTCTTCCCTGCGGCCTATGGG - Intergenic
933746887 2:85578087-85578109 GTGTGTCCACTGAGTCCTTTGGG + Intronic
947135946 2:226976775-226976797 GTGTCTGGAGTGAGGCCTCTTGG + Intronic
948090010 2:235285630-235285652 GTGACTGAACTGATCCCTATAGG + Intergenic
1168901359 20:1367794-1367816 GTGCCTTCACTCAGGCATATGGG - Intronic
1169081116 20:2798279-2798301 GTGTCTGCAGTCAGGCCTGGAGG - Exonic
1175171764 20:57085957-57085979 GGGGCTGCCCTGAGGCCTCTGGG - Intergenic
1175421924 20:58840173-58840195 GTGGCTGCCCGGCGGCCTATGGG - Intronic
1178119478 21:29453711-29453733 GTGTCTGCACTGCGGAGTGTTGG + Intronic
1178626423 21:34222630-34222652 GTGGCTGCAGTGAGGACTCTGGG + Intergenic
1181066530 22:20308963-20308985 GTGTCTGTCATGAGGCTTATGGG + Intergenic
1183196326 22:36356088-36356110 GTGTCTGGGCTGAGGCCGCTGGG - Intronic
1184661725 22:45968558-45968580 GGTTGTGCACTGAGGCCTGTAGG - Intronic
1203283383 22_KI270734v1_random:142598-142620 GTGTCTGTCATGAGGCTTATGGG - Intergenic
950175514 3:10870885-10870907 TTGTCTGCACTGTGGTCTTTGGG + Intronic
962608448 3:137052056-137052078 GTGTGTGCACTGGGGCCTATTGG + Intergenic
962875879 3:139535743-139535765 GAGTCTGAACTGTGGCTTATAGG - Intronic
965047096 3:163593244-163593266 TTGTCTGCCCTCAGCCCTATAGG - Intergenic
965818033 3:172656911-172656933 ATGTCTGCAGTGAGGCCAAGTGG - Intronic
968978286 4:3833294-3833316 CTGGCTGCACTGAGGCCCACAGG + Intergenic
972319931 4:37964290-37964312 GTGCATGCACTGAAGCCTAGGGG - Intronic
986280286 5:6316665-6316687 ATGTTTGCACTGAGGTCTGTGGG + Intergenic
989841115 5:46071779-46071801 GGGAATGCCCTGAGGCCTATTGG + Intergenic
989851885 5:46223510-46223532 GACAGTGCACTGAGGCCTATGGG + Intergenic
990881197 5:60541214-60541236 GTGTCTGCTCTGATGTCTGTGGG - Intergenic
991618153 5:68518063-68518085 GATTCTGCACAGAGGCCTAGGGG + Intergenic
991972130 5:72151329-72151351 GTGTCTGAGGTGAGGCCTAGTGG - Intronic
993685615 5:90933910-90933932 GTGGCTGCACGTAGGCCTTTGGG + Intronic
997349851 5:133222834-133222856 GTGTGTCCCCTGAGGCCTACTGG + Intronic
1002571319 5:180140772-180140794 GTGGCTGCACTGAGGGCTGACGG + Intronic
1004735373 6:18400634-18400656 GTGTCATCACTGAAGCCTACAGG - Intronic
1005414704 6:25587394-25587416 GTGTCTGGACAGAGGCTTGTGGG + Intronic
1009262068 6:61504384-61504406 GGGAGTGCATTGAGGCCTATGGG - Intergenic
1010664562 6:78613341-78613363 GTGTCTACACTGTGGCTTTTTGG - Intergenic
1018301939 6:162412318-162412340 GTGTCTGGACTGAGGATTCTAGG + Intronic
1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG + Intergenic
1021081539 7:16370792-16370814 GTGTCTGCAGTGTGGTGTATGGG - Intronic
1022539387 7:31121824-31121846 TTGCCTGCCCTGTGGCCTATGGG + Intergenic
1025501066 7:61298540-61298562 GTGAGCTCACTGAGGCCTATGGG - Intergenic
1025515926 7:61644763-61644785 GTGAGCTCACTGAGGCCTATGGG - Intergenic
1025536559 7:61955630-61955652 TGGAGTGCACTGAGGCCTATGGG + Intergenic
1025540264 7:62073589-62073611 GTGAGCTCACTGAGGCCTATGGG - Intergenic
1025572441 7:62592843-62592865 GTGAGTGCTTTGAGGCCTATGGG - Intergenic
1026354174 7:69542866-69542888 TTGTCTTCTCTGAGACCTATGGG - Intergenic
1027435959 7:78164468-78164490 ATGTCTGCACAAATGCCTATAGG - Intronic
1029227585 7:99039248-99039270 GTGTTTGAACTGATGCCTTTGGG - Intronic
1031997957 7:128245268-128245290 GTGTGTGAACTGAGGCCTGAAGG - Intronic
1034981913 7:155484599-155484621 GTGTCTGCAGTCAGGCCCAGTGG + Intronic
1038516501 8:28191893-28191915 CTGTCTGCTCCGAGGCCTGTGGG + Intergenic
1040132953 8:43818759-43818781 GGGAGTGCACTGAGGCCTGTAGG + Intergenic
1040134379 8:43835638-43835660 GTGAGCCCACTGAGGCCTATTGG + Intergenic
1040138990 8:43888339-43888361 GTGAGTGCATTGAGGCCTATGGG + Intergenic
1041757938 8:61334426-61334448 GTGTCTTCTCTAAGTCCTATGGG + Intronic
1044585373 8:93864800-93864822 GTGCCTGCACTAAGGCATACTGG + Intronic
1045241895 8:100410029-100410051 GGCTCTGCACTGAGACCTCTGGG - Intergenic
1047089430 8:121557346-121557368 GTGGCTGTGCTGAGGCCTCTGGG - Intergenic
1048815054 8:138325073-138325095 GTGTCTCCTCTGAGGGCTAGAGG + Intronic
1048910634 8:139131449-139131471 GTGTCTTCAATCAGTCCTATGGG + Intergenic
1049795553 8:144495873-144495895 GTGCCTGGCTTGAGGCCTATGGG - Intronic
1051370476 9:16355100-16355122 GTGGCTACACTGAGTCCTGTGGG - Intergenic
1053057188 9:35000265-35000287 GTGTCTACACAGAGGCCAAAGGG - Intergenic
1056566699 9:87779045-87779067 GTGACTGTACTGAAGACTATAGG + Intergenic
1057882776 9:98806012-98806034 GTGTCTGAACAGAGGCCAAAGGG + Intergenic
1062160899 9:135079190-135079212 GTGTCTGCACCGAGTGCTCTGGG + Intronic
1062282487 9:135758238-135758260 GTGTCTCGGCTGAGGCCCATGGG - Intronic
1203683411 Un_KI270757v1:9651-9673 GTGAGTGCTTTGAGGCCTATGGG - Intergenic
1185659705 X:1717713-1717735 GTGTCTGCACTTTGGCCTCTTGG + Intergenic
1188442502 X:30226821-30226843 GTGACTGCACTGAAAACTATAGG - Intergenic
1191578224 X:62730820-62730842 GGGAGTCCACTGAGGCCTATGGG - Intergenic
1195429342 X:104770905-104770927 GAATCTCCACTGGGGCCTATTGG - Intronic
1198513804 X:137383321-137383343 GTTACTGCACTGAAGACTATAGG + Intergenic
1198541167 X:137641295-137641317 GGGGCTGCACTGAGACCTTTTGG + Intergenic
1198966572 X:142233458-142233480 GTGGCTGCTCAGAGGTCTATTGG - Intergenic
1200003414 X:153073180-153073202 GAGGCTGCCCTGAGGCCTATGGG + Exonic
1200004309 X:153076829-153076851 GAGGCTGCCCTGAGGCCTATGGG - Intergenic