ID: 1091602795

View in Genome Browser
Species Human (GRCh38)
Location 12:1928195-1928217
Sequence GCAAGCTGCCAGCCTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091602795_1091602799 7 Left 1091602795 12:1928195-1928217 CCTGGTCCAGGCTGGCAGCTTGC No data
Right 1091602799 12:1928225-1928247 TTGCTCTTCTGAGCTCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091602795 Original CRISPR GCAAGCTGCCAGCCTGGACC AGG (reversed) Intergenic
No off target data available for this crispr