ID: 1091603344

View in Genome Browser
Species Human (GRCh38)
Location 12:1930864-1930886
Sequence CCTGAAATGCTGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091603344_1091603350 4 Left 1091603344 12:1930864-1930886 CCTGCTGCCCTCAGCATTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 274
Right 1091603350 12:1930891-1930913 CCTCCAGCCAGCTCCCCTCAGGG 0: 1
1: 0
2: 6
3: 47
4: 404
1091603344_1091603353 11 Left 1091603344 12:1930864-1930886 CCTGCTGCCCTCAGCATTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 274
Right 1091603353 12:1930898-1930920 CCAGCTCCCCTCAGGGCCACAGG 0: 1
1: 1
2: 3
3: 33
4: 342
1091603344_1091603354 15 Left 1091603344 12:1930864-1930886 CCTGCTGCCCTCAGCATTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 274
Right 1091603354 12:1930902-1930924 CTCCCCTCAGGGCCACAGGATGG 0: 1
1: 1
2: 4
3: 58
4: 385
1091603344_1091603348 3 Left 1091603344 12:1930864-1930886 CCTGCTGCCCTCAGCATTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 274
Right 1091603348 12:1930890-1930912 TCCTCCAGCCAGCTCCCCTCAGG 0: 1
1: 0
2: 4
3: 47
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091603344 Original CRISPR CCTGAAATGCTGAGGGCAGC AGG (reversed) Intergenic
900095896 1:940006-940028 CCTGGGAGGCTGAGTGCAGCGGG - Intronic
900630249 1:3631284-3631306 CCCATAAAGCTGAGGGCAGCGGG + Intronic
901780872 1:11593834-11593856 CCAGAAATCCTGGGGGAAGCTGG - Intergenic
902042057 1:13499710-13499732 CCTGAAAAGATAAGGGGAGCAGG + Intronic
902529443 1:17081087-17081109 CCTGGAATACTGAAGGCAGGTGG + Intronic
902529845 1:17083901-17083923 CCTGAGATGGTGACAGCAGCTGG + Intronic
902667491 1:17949729-17949751 GGGGAAATTCTGAGGGCAGCCGG + Intergenic
902844080 1:19095763-19095785 CCTGAAATGAAGAGGACAGGAGG + Intronic
903350677 1:22714600-22714622 GATCAAATGCTGAGGGCAGCAGG + Intronic
904294222 1:29507290-29507312 GCTGAAATGCTGAGGAGAGATGG - Intergenic
904860328 1:33533075-33533097 CCTGCAAGGCGGATGGCAGCTGG - Exonic
905803683 1:40861563-40861585 CGTGAGCTGCTGAGGGCGGCCGG - Exonic
906245642 1:44271832-44271854 CCAGGCATGCTGATGGCAGCTGG + Intronic
908424674 1:63994927-63994949 CCTGAAATGCTGATAGCTGTGGG + Intronic
915196556 1:154194137-154194159 CCGGAAAGCCTCAGGGCAGCTGG - Intronic
917360879 1:174174701-174174723 CCTGAAGTTCTGAGGTCAGAGGG + Intronic
919932671 1:202231432-202231454 CTTGAAAGGATGAGGGCAGCAGG - Intronic
922591644 1:226781818-226781840 CCTGAAAGACTCAAGGCAGCAGG - Intergenic
923065766 1:230515924-230515946 CCTGGTCTGCTGAAGGCAGCAGG - Intergenic
924132975 1:240931936-240931958 CCTGGAATGATGAGGCCTGCAGG + Intronic
924927315 1:248695751-248695773 CCTGCAAATGTGAGGGCAGCTGG - Intergenic
1063329545 10:5143392-5143414 CCTGAGAAGCTGAGGGCCACTGG - Intergenic
1063461001 10:6215039-6215061 CCTCAACTCCTGAGGACAGCAGG - Intronic
1064003885 10:11685025-11685047 CGTCAGATCCTGAGGGCAGCTGG - Intergenic
1064873542 10:19966849-19966871 CCTGCAATGCAGAGGCCAGGGGG + Intronic
1065288449 10:24207408-24207430 CCTGAAAGGCTGAACACAGCAGG + Intronic
1067221276 10:44345980-44346002 CCTGGGATGGTTAGGGCAGCGGG + Intergenic
1069936529 10:71921453-71921475 GTTGAAATCCTGAGCGCAGCTGG - Intergenic
1070225757 10:74503875-74503897 CCTGACAAGATGATGGCAGCTGG - Intronic
1072681499 10:97510629-97510651 ACTGTAAGGCTGGGGGCAGCTGG - Intronic
1074415135 10:113261038-113261060 TCTCCAATTCTGAGGGCAGCTGG + Intergenic
1074671655 10:115798402-115798424 CCAGCAGTGCTGAGGGCAACAGG - Intronic
1076192044 10:128489875-128489897 CCTCAGATGCTGGGGTCAGCTGG - Intergenic
1077068085 11:653714-653736 CCGGAAACCCTGAGGGCTGCTGG - Intronic
1077084091 11:739219-739241 CTTGAAATCCTGAGCTCAGCCGG - Intergenic
1077339633 11:2020553-2020575 CCCGAAATGCTGAACTCAGCAGG + Intergenic
1077365823 11:2161199-2161221 CCTGGAGGGCTGAGGGCTGCTGG + Exonic
1077517458 11:3010489-3010511 TTTGAAATGCTGAGGGCATCAGG + Intronic
1077873298 11:6281455-6281477 GCTGAAATGCAGGGAGCAGCCGG + Intergenic
1080047174 11:27821310-27821332 CCAGAACTGCTCAAGGCAGCTGG - Intergenic
1080684301 11:34502654-34502676 CCTGAAATCCCGAGGGCCGGTGG + Intronic
1081992448 11:47345213-47345235 CCTGAACTGCTGAGCCCAGAGGG - Intronic
1082940905 11:58704047-58704069 CCAGCACTGCTGAGGGTAGCAGG - Intronic
1083486859 11:62988530-62988552 GGTGGAGTGCTGAGGGCAGCAGG + Intergenic
1083645173 11:64167949-64167971 CCTGGAATGCTGGGGGCCGTGGG - Intergenic
1084219694 11:67670448-67670470 CCCGCATTGCTGAGGGCAGTGGG + Intronic
1086337413 11:85812801-85812823 CCTGCCTTGCTGAGGGAAGCAGG + Intergenic
1088796820 11:113272244-113272266 CCTGAAAGGATAAGGGAAGCTGG + Intronic
1089013888 11:115151310-115151332 CAGGAATTGCTGAGTGCAGCGGG - Intergenic
1089265432 11:117256508-117256530 CCTGGAAAGCTGAGCTCAGCTGG + Intronic
1089726151 11:120482147-120482169 CCTGAAATGCTTCGGGTAGTTGG + Intronic
1089937291 11:122377329-122377351 GCTGAAATGCTGAAGGAGGCGGG + Intergenic
1091222276 11:133936542-133936564 CCAGAAATCAAGAGGGCAGCTGG + Intronic
1202822618 11_KI270721v1_random:75742-75764 CCCGAAATGCTGAACTCAGCAGG + Intergenic
1091600761 12:1916469-1916491 ATTGAAATTCTGAGGGCAGGAGG + Intronic
1091603344 12:1930864-1930886 CCTGAAATGCTGAGGGCAGCAGG - Intergenic
1092214146 12:6668755-6668777 CTTGAAATTTTGAGGGGAGCTGG - Intronic
1093672003 12:21888097-21888119 CCTAAATTGCTGAGGACAGAGGG + Intronic
1095734661 12:45543400-45543422 CCTGAGAAGCCAAGGGCAGCAGG + Intergenic
1096056881 12:48660498-48660520 CTGGAAATGCAGTGGGCAGCAGG + Exonic
1096543836 12:52323457-52323479 GGTGAAATGCTGAGGACTGCAGG + Intergenic
1097266147 12:57745922-57745944 CCTGAAGTGATGGGGGCAACCGG + Intronic
1098190438 12:67942696-67942718 ACTGAAATGCTTAGGGAAACTGG + Intergenic
1099060048 12:77896781-77896803 CCTAAAATACTTAGGACAGCTGG - Intronic
1099400133 12:82193720-82193742 ACGGAAAGGCTGATGGCAGCTGG - Intergenic
1101625523 12:106436923-106436945 CCTGGATTGCTGAGGACACCAGG - Intronic
1101778784 12:107817261-107817283 CTTGGAATGATGAGGGCAGGTGG + Intergenic
1101849133 12:108388389-108388411 CCTGAAGTGGTGAGGGCAAGGGG - Intergenic
1101996052 12:109525490-109525512 CCTGAGATGCTGACAGCAGTGGG + Intronic
1104004843 12:124884734-124884756 CAAGAAATGCCGAGGGCTGCTGG + Intergenic
1104221226 12:126786753-126786775 CCTGGAATGCACAGGGCACCTGG + Intergenic
1104700018 12:130895849-130895871 CCTCGAAGGCTGAGGGCACCTGG + Intergenic
1104932882 12:132348996-132349018 CCTGGAATGCAGCGGGCAGAGGG + Intergenic
1105594745 13:21826924-21826946 CCTGGAATGCTGGGGGGAGGAGG + Intergenic
1105967493 13:25397918-25397940 CCTGAATTGTTGAAGGCAGCGGG + Intronic
1107475579 13:40732623-40732645 CCTGGAACGCTGGGGGCAGAAGG + Intronic
1109503778 13:63272604-63272626 CCTGAAAAGCTGAATTCAGCTGG + Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1113047160 13:106168439-106168461 CCCGGTATGCTGAGGGCTGCAGG - Intergenic
1114679052 14:24468290-24468312 TCTGAATTCCTCAGGGCAGCAGG + Intergenic
1119614972 14:76093000-76093022 CCTGAGATGGTGAGGGCTGATGG - Intergenic
1120759143 14:88270541-88270563 CCTGAAATTTTGAAGACAGCAGG - Intronic
1121611781 14:95285906-95285928 CCTGGAGTGCTGAGTGCAGAAGG - Intronic
1122006197 14:98705875-98705897 TGTGAAATGGGGAGGGCAGCAGG + Intergenic
1122264242 14:100539297-100539319 CCTGGAAATCCGAGGGCAGCTGG + Exonic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1124400465 15:29343497-29343519 CCTGAAATCTGTAGGGCAGCAGG - Intronic
1124704691 15:31954058-31954080 CCTGAGCTGCTGTGAGCAGCAGG + Intergenic
1125595987 15:40886385-40886407 CCTGCAGTCCTGAGGGCAGTGGG + Intergenic
1125733297 15:41906551-41906573 CCTGCAATGGTGAGGGCAGAGGG - Intronic
1129467752 15:75733383-75733405 CCTGATTTGCTGCGGGCAGGAGG - Intergenic
1129677794 15:77641852-77641874 CCTGATAGGCTGAGGCCAGCTGG + Intronic
1129719466 15:77870203-77870225 CCTGATTTGCTGCGGGCAGGAGG + Intergenic
1130203730 15:81856383-81856405 CATGAAATGTTGCAGGCAGCTGG + Intergenic
1130256303 15:82327584-82327606 CCTGCCATGGAGAGGGCAGCTGG - Intergenic
1130598648 15:85262404-85262426 CCTGCCATGGAGAGGGCAGCTGG + Intergenic
1131712231 15:95068372-95068394 CAGGAAATGCTGGGGGCACCAGG - Intergenic
1132513293 16:354299-354321 CCTGAAGGGCTGTGGGCAGCAGG - Intergenic
1132971894 16:2693210-2693232 CCTGCCATGCTGAGGGCAGTGGG + Intronic
1133052341 16:3124312-3124334 CCTGAATGGCTAAGGGCAGGGGG - Intergenic
1133104852 16:3500855-3500877 CCTGAGACGCCGAGGGCAGAGGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134221352 16:12356896-12356918 TCTGAAATGCAGAGGACATCTGG - Intronic
1134915251 16:18063893-18063915 CCTGTAATGCAAAGAGCAGCAGG + Intergenic
1136511021 16:30738411-30738433 CCTGACATGCTGCGGACAGACGG - Exonic
1137365784 16:47858407-47858429 TCTGAGATGCCAAGGGCAGCAGG - Intergenic
1137773439 16:51036677-51036699 CCTGAGATGGTGATGGCAGGTGG + Intergenic
1138413948 16:56860542-56860564 CCTGAAATGGTGAGGACAGAAGG - Intergenic
1140154287 16:72406628-72406650 CTTAAAGTGCTGAGGGAAGCAGG + Intergenic
1140708476 16:77653879-77653901 CCTGGGATGGTGATGGCAGCAGG - Intergenic
1141714288 16:85717833-85717855 CCAGCAATGGTGAGGGCAGTGGG - Intronic
1142497042 17:311410-311432 TCTGAAAGGCTGAGGGCAGAGGG - Intronic
1143728343 17:8865553-8865575 CCTGAAACCCTGAGGGCACGAGG - Intronic
1147359258 17:39920998-39921020 CCTGGAAGGCTGAGGGGAGGGGG - Intergenic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148767843 17:50049582-50049604 CGTTGTATGCTGAGGGCAGCAGG + Intergenic
1152193311 17:78901751-78901773 CCTGAAATGCTTGGGGAAGAGGG + Intronic
1153621567 18:6983519-6983541 TGAGGAATGCTGAGGGCAGCTGG - Intronic
1153625120 18:7016034-7016056 CAGGAGATGCTGAGGGAAGCGGG + Intronic
1157406328 18:47425074-47425096 CCTGAAATGCTGAGGCCTCTTGG - Intergenic
1157700315 18:49758111-49758133 GCTGAGCAGCTGAGGGCAGCAGG + Intergenic
1159935305 18:74360966-74360988 CCTGGAAAGCTGAGAGCACCGGG + Intergenic
1159986221 18:74844356-74844378 TCTGAAGTCCTGAGGGAAGCTGG - Intronic
1160418409 18:78727639-78727661 CCTGACATGCTGAGGACAACAGG + Intergenic
1160425853 18:78778686-78778708 CCTGAAATGCTGACGGAGGTGGG + Intergenic
1160461747 18:79043904-79043926 CCTAACACGCTGAGGGCACCTGG - Intergenic
1160529951 18:79556967-79556989 CCTGAGATGCTGTGAGCACCAGG + Intergenic
1160663924 19:314067-314089 CCTGAAATGCAGAGGCCTGAGGG + Intronic
1160765784 19:807047-807069 CCTGAAATGCTGATTCCAGGAGG - Intronic
1161547831 19:4892844-4892866 CCTGAAATGCTGGGAGCGCCTGG - Intronic
1161562172 19:4979493-4979515 CCTGGCATGCTGGAGGCAGCTGG + Intronic
1161945764 19:7435527-7435549 CCCGAGGTGATGAGGGCAGCGGG + Intronic
1162832756 19:13297304-13297326 CCTGAAATGCTCAAGGCCTCTGG + Intronic
1163604561 19:18266888-18266910 CCTGAGCTGCTGGGGGCTGCAGG + Exonic
1164415025 19:28039818-28039840 CTGGAATTGCTGAGTGCAGCTGG - Intergenic
1164538876 19:29107434-29107456 CCAGCATTGCTGAGGGCAGATGG - Intergenic
1164986419 19:32651956-32651978 TATGAAATGCTCTGGGCAGCAGG - Intronic
1167636782 19:50659980-50660002 CCTGACATGGTGAGGGGAGGGGG + Intronic
925574558 2:5348045-5348067 TCTGAAGTTCTGAGGTCAGCTGG + Intergenic
926345631 2:11942554-11942576 CCTGAAATCCTAAGTGCGGCAGG - Intergenic
927793083 2:26026187-26026209 TCTGAAATGCTGATCTCAGCTGG - Intergenic
927851410 2:26502252-26502274 CCTGACAGGGTGGGGGCAGCTGG + Intronic
927894170 2:26770943-26770965 CCTGAGATGCTCAGGCCTGCAGG - Intronic
928086615 2:28350098-28350120 CCTGATAGGCTGACGGGAGCAGG + Intergenic
928425087 2:31171176-31171198 CCTGGAATGCTGAGGCCAGTTGG - Intergenic
930754824 2:54963636-54963658 CCTGAATAAATGAGGGCAGCTGG - Intronic
931141425 2:59462606-59462628 CCTGAAATTCAGAGAGGAGCCGG - Intergenic
932368588 2:71169225-71169247 CCTGGGATGATGAGGGCAGAGGG - Intergenic
934160154 2:89242023-89242045 CCTGAAGCCATGAGGGCAGCAGG + Intergenic
934207121 2:89940411-89940433 CCTGAAGCCATGAGGGCAGCAGG - Intergenic
934706237 2:96483659-96483681 CGTGAAGTGCTTAGAGCAGCTGG + Intergenic
935318260 2:101859341-101859363 ACTAGAATGCTGAGGGCAGTAGG + Intronic
935681969 2:105645807-105645829 CCTGAAAGGCTGGGTGCAGGGGG + Intergenic
937982755 2:127624814-127624836 CCTGAAGTTCTGGGGGCAGCAGG + Intronic
938127001 2:128681665-128681687 GCAGGGATGCTGAGGGCAGCAGG + Intergenic
939715974 2:145584186-145584208 CCTGAAATACTGTGGCCAACTGG + Intergenic
940913646 2:159230395-159230417 CCTGAGCTGGTGAGGGAAGCTGG - Exonic
943613496 2:190064249-190064271 TCTGAAATCCTCAGGGCATCTGG - Intronic
944673043 2:202011964-202011986 CCTGGAAAGCTGAGGCCAGAGGG + Intergenic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
947403035 2:229747869-229747891 CATGAAATTCTGAGGGCAACAGG - Intergenic
947526857 2:230882384-230882406 CATGAAATACTGAGGGGAGAGGG - Intergenic
947912570 2:233811155-233811177 CCTGCAGTGCCCAGGGCAGCTGG + Intronic
947989799 2:234477687-234477709 CAAGGAATGCTGAGGGCTGCCGG + Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948444159 2:238019278-238019300 CCAGAAGTACTGAGAGCAGCTGG + Intronic
1170428919 20:16259829-16259851 CCTGATATGCTGGGGCCATCAGG - Intergenic
1170429047 20:16260249-16260271 CCTGATATGCTGGGGCCAGCAGG - Intergenic
1170798862 20:19573630-19573652 ACCAACATGCTGAGGGCAGCAGG - Intronic
1171023020 20:21603702-21603724 CCTGAAGTGGTAAGGGCAGTGGG - Intergenic
1171162584 20:22941418-22941440 CATGAAAAGCAGGGGGCAGCAGG + Intergenic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1175055666 20:56195355-56195377 CCAGCAGTGCCGAGGGCAGCAGG + Intergenic
1175535327 20:59707092-59707114 GCTGAAAAGCTAAGGGCATCAGG + Intronic
1175798464 20:61787048-61787070 CATGAAATGATGATGACAGCAGG + Intronic
1175837282 20:62004197-62004219 CCTGGGTTGCTGAGGTCAGCAGG - Intronic
1177891463 21:26808928-26808950 TCTGAAATGCTGAGAGAAACTGG + Intergenic
1178534150 21:33398802-33398824 CCTGAAGTCCTCAGGGCAGGAGG + Intergenic
1178642467 21:34356211-34356233 CCCGGAATGCTTAGTGCAGCTGG - Intergenic
1179033076 21:37736849-37736871 CGTGAAATGCTGAAGTCAGTTGG - Intronic
1179102491 21:38366458-38366480 CCTGAAATCCTTAGGCTAGCAGG - Intergenic
1179591172 21:42409627-42409649 CCTTCAATGCTCACGGCAGCTGG + Intronic
1179905121 21:44418694-44418716 CCTGCAATGCTGCAGGCATCCGG + Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1183981066 22:41540584-41540606 CCTGTAAGGCTGAGGGCGGAAGG - Intronic
1184190745 22:42892753-42892775 CCTGATTGGCTGAGGACAGCTGG + Intronic
1185366666 22:50440005-50440027 GCAGCCATGCTGAGGGCAGCCGG + Exonic
949108368 3:227669-227691 CCTGAAAAGCTGAGAGCTACTGG - Intronic
950138072 3:10596783-10596805 CCTGAGCTGCTGCTGGCAGCTGG - Intronic
951266596 3:20575126-20575148 CCTGACATGCTGAGGAGAACTGG + Intergenic
954460789 3:50625814-50625836 CCTGGCAGGCTGAGGGCAGGCGG + Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
957664624 3:83210216-83210238 CCCGAAATAGAGAGGGCAGCTGG - Intergenic
959523641 3:107349897-107349919 CCTGGAATGCTGGGCTCAGCTGG + Intergenic
961243743 3:125434142-125434164 GATGAAATGCTCTGGGCAGCTGG + Intergenic
962765977 3:138562813-138562835 CCTGTAATTATGATGGCAGCTGG - Intronic
962991089 3:140578050-140578072 CTTGAATTCCTCAGGGCAGCAGG + Intergenic
963699186 3:148602393-148602415 CCTGGGAGGCTGAGGGTAGCAGG - Intergenic
964850971 3:161095712-161095734 GCTGCAAGGCTGGGGGCAGCAGG + Intronic
966724187 3:183094343-183094365 TCTAAAATACAGAGGGCAGCCGG - Intronic
967801121 3:193661227-193661249 CCTGAAATCCTGTGGGGAGAAGG - Intronic
968296083 3:197577564-197577586 CCTGTAATGCTGGGTGCAGAGGG - Intergenic
968662867 4:1805984-1806006 CCTGAGATGCTGGGAGCAGCGGG + Intronic
968708058 4:2092699-2092721 CCACAAATGCTGAGGGCATGGGG - Intronic
969835218 4:9834936-9834958 CCTGCAATGATGAAGGCAGCCGG + Exonic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
971308061 4:25501061-25501083 CTGGAACTGCTGAGAGCAGCTGG + Intergenic
978913525 4:114095401-114095423 CCTGTACTGGAGAGGGCAGCTGG - Intergenic
981903861 4:149896832-149896854 CCAGAAATGCAGAGGGGAGAGGG + Intergenic
982797075 4:159659160-159659182 CCTGAGATCCTGAGGGCAAGGGG - Intergenic
984763579 4:183383115-183383137 TGTCAAATGCTGAGGACAGCAGG + Intergenic
985236698 4:187883169-187883191 CAGGAAATGCGGAGGGCAGTGGG + Intergenic
985966626 5:3342941-3342963 CCTGAGATGCTGAGGGGCTCTGG - Intergenic
987537764 5:19209475-19209497 CCTGCAATGTGGTGGGCAGCAGG - Intergenic
988633028 5:32951549-32951571 GATGACATGCTGAGGGCAGCTGG + Intergenic
988771924 5:34440893-34440915 CCTGAAATGTGGATTGCAGCAGG - Intergenic
992914672 5:81435899-81435921 CCTGAGATGCTGGGTGCAGTGGG + Intronic
993942913 5:94082785-94082807 CCTCACATGCTGAGACCAGCAGG + Intronic
995425220 5:112013767-112013789 AGTGAAGTGCTGAGGGGAGCAGG + Intergenic
997523513 5:134538228-134538250 CCTGGAAGGCTGAGGGAAACTGG - Intronic
997601514 5:135141750-135141772 CGTGAATTGTTGAGGGCACCTGG + Intronic
999385033 5:151148014-151148036 CCTGAAGGGCTGGGGGCAGCTGG - Intronic
1000341358 5:160279582-160279604 CCTCACCTGCTGAGGGCAGTGGG + Intronic
1000711264 5:164581918-164581940 CCTGAATTGGTGTGGGCATCTGG + Intergenic
1001268084 5:170289541-170289563 CCAGAAGTCCTGAGGGCATCGGG + Intronic
1001544912 5:172565069-172565091 CCTGCTACGCTGATGGCAGCTGG + Intergenic
1001759342 5:174194589-174194611 ACTGAGATGCTGAGGTCACCTGG - Intronic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1002295014 5:178225482-178225504 AGAGAAATGCTGAGGGCAGGAGG + Intronic
1002434529 5:179222517-179222539 CTTGCAGTGTTGAGGGCAGCTGG - Intronic
1002816771 6:688345-688367 CCTGAGTTGCTGGGGCCAGCTGG - Intronic
1003011775 6:2433665-2433687 GCTGAGATACAGAGGGCAGCGGG - Intergenic
1003314967 6:5003851-5003873 CCCGAAAAGCCGAGGACAGCCGG + Intronic
1003635664 6:7829310-7829332 CCAGAAATGTTGATGGGAGCAGG + Intronic
1003964682 6:11241781-11241803 CCTCAGCTGATGAGGGCAGCGGG - Intronic
1004457591 6:15805298-15805320 GCAGAAATGTTGAGGGCAGGTGG - Intergenic
1006379564 6:33689587-33689609 CCTCAACACCTGAGGGCAGCTGG + Intronic
1006641446 6:35491708-35491730 CCTGAAAGGCTGAGGGCCCTGGG - Intronic
1006791456 6:36703954-36703976 CCTGAAGAGATGAGGGCAGGTGG + Intronic
1008928711 6:56914561-56914583 CCTAAAATAGTGAGGGAAGCAGG - Intronic
1009495571 6:64342289-64342311 CCAAAAATGTTAAGGGCAGCCGG + Intronic
1010489190 6:76453291-76453313 TCTTGAGTGCTGAGGGCAGCTGG - Intergenic
1012672382 6:102071098-102071120 CTTGAAAAGTTGAGGGCAGCAGG - Intergenic
1013638508 6:112051186-112051208 TGTGAAATGCTGGCGGCAGCAGG - Intergenic
1014042195 6:116841178-116841200 ACTGGAATGATTAGGGCAGCCGG - Intergenic
1014525464 6:122496042-122496064 CATGAAAAGCTCAGGGCACCAGG + Intronic
1015565176 6:134562860-134562882 CCTCAATTGCAGAGGGCAGGTGG - Intergenic
1018720294 6:166566798-166566820 CCTGACAGGCTCAGGGAAGCTGG + Intronic
1018935226 6:168269620-168269642 CCTGGCAGGCTGCGGGCAGCAGG + Intergenic
1019526901 7:1484601-1484623 CTAGAGATGCTGAGGACAGCGGG + Intronic
1019774429 7:2904014-2904036 GATGAAATGGTGAAGGCAGCAGG - Intergenic
1021896964 7:25246144-25246166 CCAGTAATGCTTAGGGCTGCTGG - Intergenic
1022207681 7:28180010-28180032 CCCGAGGCGCTGAGGGCAGCGGG - Intronic
1022924921 7:35047065-35047087 CCTGTCATGCTGAGGGGAGGAGG + Intergenic
1023373048 7:39530874-39530896 CATGAAACGCTGAGCACAGCAGG - Intergenic
1024874689 7:54008784-54008806 AATGAGAAGCTGAGGGCAGCTGG + Intergenic
1025942945 7:66087042-66087064 CATGTCAGGCTGAGGGCAGCAGG - Intronic
1026073661 7:67145684-67145706 CTTGAAATACAGTGGGCAGCAGG - Intronic
1026703225 7:72666492-72666514 CTTGAAATACAGTGGGCAGCAGG + Intronic
1026867198 7:73831153-73831175 CCTGGAAGGCTGAGGGGATCCGG - Exonic
1027917008 7:84337717-84337739 CCTTAAATGCTTTGTGCAGCTGG + Intronic
1028828891 7:95305359-95305381 CCAGAATTGGTGGGGGCAGCAGG + Intronic
1029108390 7:98196573-98196595 CCTGAAAGCCTGGGGGTAGCTGG + Intronic
1029822932 7:103161770-103161792 CCTGTCATGCTGAGGGGAGGAGG + Intergenic
1030716733 7:112816282-112816304 CCAGAAAAGGTGAGGGCAGGTGG - Intergenic
1034555162 7:151845702-151845724 ACCTAAATGCTGAGGGCGGCAGG + Intronic
1034991605 7:155551094-155551116 CCTGATATCCTGTGGGCAGTGGG - Intergenic
1035266662 7:157693185-157693207 CCAGCCAGGCTGAGGGCAGCAGG - Intronic
1037446985 8:18975070-18975092 CCTGCAGTGCTGAGGCCTGCTGG + Intronic
1041391998 8:57355120-57355142 TCGGAAATGCTGAAGGCTGCTGG + Intergenic
1042271697 8:66962191-66962213 CGTGAAAGGCCGAGGGCGGCTGG - Intronic
1043288923 8:78571383-78571405 ACTGAAATGCTGAGTGTAGGGGG - Intronic
1047267376 8:123319052-123319074 CCTGGGAGGCTGAGGGCAGGAGG - Intergenic
1048154009 8:131924608-131924630 CCAGAAAGGCTGAGGGAAACAGG - Intronic
1048736932 8:137512652-137512674 ACTGCATTGCTGAGGGAAGCAGG + Intergenic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1052068098 9:24047920-24047942 CCTCAAATGATGTTGGCAGCAGG + Intergenic
1054741622 9:68811598-68811620 CCTCAAAAGCAGAGGTCAGCTGG - Intronic
1055836573 9:80449670-80449692 CCTGGAATGCTAAGGGAAGATGG + Intergenic
1056377781 9:86031284-86031306 GCAGAAATCCTCAGGGCAGCAGG - Intronic
1056621894 9:88221590-88221612 CCAAAAAGGCTGAGGGCAGTGGG - Intergenic
1056724056 9:89096805-89096827 CCTAAAATGCACAGGACAGCTGG + Intronic
1056764444 9:89436308-89436330 CCTGGAAAGGTGAGGCCAGCTGG - Intronic
1059335600 9:113566731-113566753 CCAGAAGGCCTGAGGGCAGCAGG - Intronic
1060254460 9:122014881-122014903 CCAGAAATCCTGAGGGCAAGGGG + Intronic
1061912673 9:133733343-133733365 GCTGAAATGGTGAAGGCAGAAGG + Intronic
1061945574 9:133906758-133906780 CCTGGAGAGCTGGGGGCAGCGGG + Intronic
1062094247 9:134694854-134694876 CCTGAGACCCTGAAGGCAGCGGG + Intronic
1062703378 9:137919816-137919838 GCTGAAAAGCTGGTGGCAGCGGG + Intronic
1186690677 X:11972021-11972043 CCTACAATTCTGAGGGTAGCTGG + Intergenic
1190556148 X:51637550-51637572 CCTGAAATGCTAATGCCAGCTGG - Intergenic
1192227294 X:69238205-69238227 CCTGCAGGGCTGAGGGCAGAGGG - Intergenic
1193505912 X:82344743-82344765 ACTGAAATGCTGGAGGCTGCTGG - Intergenic
1195268501 X:103207656-103207678 CCTGAATAGCTGAGGACTGCAGG + Intergenic
1199622353 X:149712551-149712573 TGTGACCTGCTGAGGGCAGCGGG + Intronic
1200409857 Y:2850502-2850524 CATGAAAAGTGGAGGGCAGCAGG + Intronic
1202589290 Y:26465651-26465673 CCTGGAAGGGTGGGGGCAGCAGG - Intergenic