ID: 1091605632

View in Genome Browser
Species Human (GRCh38)
Location 12:1949164-1949186
Sequence CTGTATGGGCAGGAGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 523}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091605632 Original CRISPR CTGTATGGGCAGGAGGAGGC TGG Exonic
900359997 1:2283851-2283873 CTGCTGGGGCTGGAGGAGGCGGG + Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900822449 1:4899883-4899905 CTGCATGGACAGGGAGAGGCAGG + Intergenic
900972574 1:5999738-5999760 CTGTATGGTCAGGAACAGGGTGG - Intronic
901527914 1:9835685-9835707 CTGAAGGGGCAGCAGGAGGGAGG + Intergenic
901875812 1:12166723-12166745 CTGGGAGGGCAGGTGGAGGCCGG + Intergenic
901876509 1:12169825-12169847 CTGTCTGGGGAGGAGGATGAGGG + Intronic
901882383 1:12201944-12201966 CTGGATGGGCAGGGGGTGGTAGG - Intronic
901906143 1:12413359-12413381 CTGTAGGGGGAGGCTGAGGCAGG + Intronic
902148215 1:14420946-14420968 CTCTCTGGGCTGGCGGAGGCCGG - Intergenic
902540857 1:17153500-17153522 CTGTATGGGAAGAATGATGCTGG - Intergenic
903603630 1:24559380-24559402 CTAGGTGGGCAGGAGGCGGCAGG + Intronic
904291698 1:29490390-29490412 CTCTAGGGGAAGGAGGAGGTGGG + Intergenic
904384572 1:30132849-30132871 GTGCATGGGCAGGAGGGGTCAGG + Intergenic
904391799 1:30190907-30190929 CAGGATGGGCACCAGGAGGCAGG + Intergenic
904521995 1:31102785-31102807 CAGTATGGGGAGGTGGAGTCAGG - Intergenic
904607256 1:31704539-31704561 CTGTACTGGGAGGAGGAGGGTGG + Intergenic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
905258069 1:36698235-36698257 GTGTATGTACAGGAGGAGGGGGG - Intergenic
905615456 1:39394509-39394531 CTGTTTGGGGAGGCTGAGGCAGG + Intronic
907486969 1:54784834-54784856 CTGTGTGGGCTCTAGGAGGCAGG + Intronic
908642559 1:66241615-66241637 CTGTATCGGGAGGCTGAGGCAGG - Intronic
909219009 1:72930388-72930410 CTGTAAGGCAAGGATGAGGCAGG - Intergenic
911950823 1:104172268-104172290 CTGTCTGGGCTGGCCGAGGCCGG + Intergenic
912498598 1:110107068-110107090 CTATATGGGCTGGAGGCAGCAGG + Intergenic
914433742 1:147641849-147641871 CGGGAAGGGCAGGCGGAGGCGGG + Intronic
914757806 1:150574885-150574907 TTATAGGGGGAGGAGGAGGCAGG - Exonic
914916378 1:151821916-151821938 GGGTAAGGGCAGGAGGAGGCTGG - Intronic
915435022 1:155897875-155897897 ATGTTTGGGGAGGAGGAGGGGGG - Intronic
915444475 1:155966960-155966982 CTGTGTGGCCAGGAGGAGATGGG - Intronic
915754916 1:158250178-158250200 CTGTATGGGCAGACAGTGGCAGG + Intergenic
916353083 1:163874358-163874380 CACTTTGGGCAGGAGGAGGGAGG + Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
919854051 1:201693757-201693779 CTGAATGGGCAGGAGTATGTGGG + Intronic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920308584 1:205034521-205034543 TGGTATGAGCTGGAGGAGGCAGG + Intergenic
920717602 1:208355406-208355428 TTGTTTTGGCAGCAGGAGGCAGG + Intergenic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
923544403 1:234913837-234913859 CAGAATGGGCAGGAGGAGATCGG - Intergenic
924697336 1:246414129-246414151 CTCTAGGGGTAGGAGGAGCCTGG - Intronic
1063017952 10:2096790-2096812 CTGGAGGGGTTGGAGGAGGCTGG - Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1063371067 10:5523515-5523537 GGGTTTGGGCAGGAGGAAGCAGG - Intergenic
1063651802 10:7945590-7945612 CTGTAGGGGTGGGAGGAGGTAGG - Intronic
1063690409 10:8281850-8281872 CTGTATTGGAAGGAGTAGGTAGG + Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064680153 10:17803195-17803217 CTGAGTGGGTAGGAGGTGGCTGG + Intergenic
1065773775 10:29101178-29101200 CTGTGAGGTCAGGAGGGGGCAGG + Intergenic
1065773801 10:29101264-29101286 CTGTGAGGTCAGGAGGGGGCAGG + Intergenic
1067770116 10:49116562-49116584 CTGTAGGAGGAGGAGGAGACAGG + Intergenic
1068494159 10:57764173-57764195 TTGTTTGGGCAGGAGCATGCTGG - Intergenic
1069552875 10:69376675-69376697 CACCATGGGCAGGAGCAGGCAGG - Intronic
1069683498 10:70301330-70301352 CTGGGTGGGCATGAGGAGGGTGG + Exonic
1070122295 10:73589841-73589863 CTGTAGGGGCAGGAGGTGAAGGG + Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070605923 10:77898550-77898572 CTCTATTGGCAGGAGGAGGCAGG - Intronic
1071600917 10:86958380-86958402 CTCCATGGGCTGGAGGGGGCTGG - Intronic
1071969430 10:90888083-90888105 CTGTATTGGCAGTTTGAGGCTGG - Intronic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072335165 10:94391396-94391418 CTTTATGGGCAGTAGGAAGAAGG - Intergenic
1072552987 10:96493463-96493485 CTGTCAGGGCAGGAGCAGGAGGG + Intronic
1072619148 10:97068273-97068295 ATGTATGGCCAGGAGGGGGAGGG - Intronic
1072693058 10:97584190-97584212 CTGCCTTGGCAGGAGGAGCCTGG + Intergenic
1073058933 10:100721620-100721642 CTGTAGGGGCAGGAGGAGTTGGG - Intergenic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074358212 10:112804322-112804344 CTGGATGGGAAGGTGGGGGCAGG - Intronic
1074849397 10:117427048-117427070 CTGTATGTCCAGGTGAAGGCTGG + Intergenic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076404622 10:130203735-130203757 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404630 10:130203754-130203776 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404638 10:130203773-130203795 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076439986 10:130474995-130475017 CCCTATGGGCTGGAGGAGCCTGG - Intergenic
1076519654 10:131073648-131073670 CTGGATGGGCAGGATGTGGATGG + Intergenic
1076589603 10:131574075-131574097 CTGGATGGGAAGGTGGGGGCTGG - Intergenic
1076925469 10:133481752-133481774 CTGTATGGGTAGGTGCAGTCAGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077500565 11:2908144-2908166 CTGGATGGGCAGGGGGTGGGAGG - Intronic
1078404621 11:11059385-11059407 CTTTATGGGTATGATGAGGCTGG + Intergenic
1078457053 11:11483569-11483591 GTGGATGGCCAGGAGCAGGCTGG - Intronic
1080027040 11:27626006-27626028 TTCTATGGGCAAGAGTAGGCTGG + Intergenic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080630871 11:34074569-34074591 CTTTATAGGTAGGTGGAGGCAGG - Intronic
1080802098 11:35618633-35618655 GAGCATGGGCAGGAGGATGCGGG + Exonic
1081642107 11:44763201-44763223 CTCTGAGGGCAGGAGGAGCCTGG + Intronic
1082834686 11:57642939-57642961 CTGTCTGGGCAGGAGAAAGGAGG - Intergenic
1083581917 11:63830483-63830505 CTGGGAGGGCAGGAGGTGGCTGG - Intergenic
1083618953 11:64039559-64039581 CTGGATGGCCGGGAGGAGACGGG + Intronic
1083920632 11:65780121-65780143 CAGTAGGGGCAGGAGCCGGCAGG + Exonic
1083939064 11:65885386-65885408 TTCTATGGGCAGGGGGAGCCTGG + Intronic
1083988619 11:66233080-66233102 CTCTAAGGGCAGGAGAAGGGAGG - Intronic
1084043757 11:66557345-66557367 GGGGATGGACAGGAGGAGGCTGG - Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084678290 11:70649631-70649653 GTGTATGGGAGGGAGGAGGGGGG + Intronic
1085390675 11:76180555-76180577 GTGTATGTGCAGGAGGTGGTGGG + Intergenic
1085643454 11:78207785-78207807 CTGCTGGGGCAGGAGAAGGCGGG + Intronic
1086205436 11:84252392-84252414 CTGTATTGGGAGGCTGAGGCGGG - Intronic
1086782103 11:90920176-90920198 CTGGATGGACAGGAGCAGGTAGG + Intergenic
1087977314 11:104565352-104565374 CTGTCTGGGCTGGGTGAGGCCGG - Intergenic
1089244786 11:117110868-117110890 CTTTCTGGGCAGGCCGAGGCCGG - Intergenic
1089737092 11:120557009-120557031 TTCTGTGGGCAGGAGGAGACTGG - Intronic
1090347760 11:126084663-126084685 GCGGATGGGCAGGAGCAGGCTGG - Intergenic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091670316 12:2447721-2447743 CTGGCTAGGCAGGAGGAGGTGGG + Intronic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1092611350 12:10176477-10176499 CTGTTTAGGCAGGTGAAGGCTGG + Intronic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1093847746 12:23994671-23994693 GTGTGTGGGCAGGAGGAGAGAGG + Intergenic
1096719636 12:53511592-53511614 TTCTATGGTAAGGAGGAGGCTGG - Intronic
1097680868 12:62647768-62647790 CTGTGTGGGCTGGAGGAGGTGGG + Exonic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1101719145 12:107335960-107335982 TTGTCGGGGCAGGAGGAGGAAGG - Intronic
1101940957 12:109098453-109098475 CCGGCTGGGCAGGAGGAGCCTGG + Exonic
1102077636 12:110072834-110072856 GCGTGTGGGCAGGTGGAGGCAGG + Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103628996 12:122244060-122244082 GTGAACGGGCAAGAGGAGGCAGG + Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1103926896 12:124428156-124428178 CTGCACTGGAAGGAGGAGGCCGG - Intronic
1104954337 12:132457137-132457159 TCGAATGGGGAGGAGGAGGCAGG + Intergenic
1104960969 12:132488641-132488663 CTGGGTGGACTGGAGGAGGCTGG + Intergenic
1105070480 12:133231563-133231585 CCGTCTGGTCATGAGGAGGCTGG - Exonic
1106356621 13:28989648-28989670 CTGGATGGGGAGGATGAGGGTGG + Intronic
1106485250 13:30166731-30166753 CTGGATGAGCAGGAGTAGGCGGG - Intergenic
1107851682 13:44577480-44577502 CTGGCGGGGCAGGAGGCGGCGGG + Intergenic
1108147859 13:47498609-47498631 CTGTCTGGGCACGAGGCAGCAGG + Intergenic
1108301797 13:49085025-49085047 CTGTAATGGCAGGAAGAAGCAGG - Intronic
1110279469 13:73676006-73676028 CTCTATGACCAAGAGGAGGCAGG + Intergenic
1111595320 13:90403814-90403836 CTGGAGGGGGATGAGGAGGCAGG - Intergenic
1112689055 13:101868853-101868875 ATGAATGGGCAGGAAGAAGCAGG + Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1114519753 14:23325725-23325747 CTGGCTGGACAGGAGCAGGCAGG - Exonic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114646604 14:24259622-24259644 CAGAAAGGGCAGGAGGAGGGTGG + Intronic
1115548934 14:34488005-34488027 CTGGAAGGGCAAGAGGAGACAGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117294060 14:54362787-54362809 GTGTATGACCAGGAGGAAGCAGG + Intergenic
1117861234 14:60094644-60094666 AGGTATGGGCAGGAGGGGTCTGG - Intronic
1118500389 14:66356844-66356866 TTGTCTGGGGAGGAGGAGGGTGG - Intergenic
1118716543 14:68564045-68564067 CTGCATGGGCTGGGGGAGGCTGG + Intronic
1118751559 14:68811386-68811408 CTGTGTGGGTGGGAGGACGCAGG + Intergenic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1119529192 14:75347784-75347806 CTGCTTGGGCAGGAGGTGGATGG + Intergenic
1119636916 14:76280651-76280673 AGGTCAGGGCAGGAGGAGGCAGG + Intergenic
1120978951 14:90274209-90274231 CAGCATGGGCAGGGTGAGGCTGG + Exonic
1121144616 14:91573637-91573659 CTGGCAGGGGAGGAGGAGGCTGG + Intergenic
1121303661 14:92891489-92891511 CAGTTTGGGCTGGAGGAAGCTGG - Intergenic
1122491453 14:102118792-102118814 ATGTATGGGGAGGGGTAGGCAGG - Intronic
1122635028 14:103125806-103125828 GGGTCTGGGCAGGAGGAGGCTGG + Intronic
1122891750 14:104735247-104735269 CTGGTGGGGCAGGTGGAGGCTGG - Intronic
1122969791 14:105147889-105147911 CTGTAAGGAGAGGAGGAGGAGGG + Intronic
1123121169 14:105917810-105917832 AGTTGTGGGCAGGAGGAGGCAGG + Intergenic
1202849536 14_GL000225v1_random:8335-8357 CGGTATGGGCAGAGAGAGGCCGG - Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1125966741 15:43880891-43880913 CTGCAATGGGAGGAGGAGGCTGG + Intronic
1126100716 15:45116782-45116804 CCGTATGAGCGGGAGGATGCAGG + Intronic
1127291955 15:57579109-57579131 CTGGAAGGGGAGGAGGAGTCAGG - Intergenic
1128389790 15:67175110-67175132 ATGGAGGGGAAGGAGGAGGCAGG + Intronic
1128757282 15:70191575-70191597 CAGCATGGCCAGGAGGAGGCGGG + Intergenic
1129664946 15:77574324-77574346 CTGACAGGGCATGAGGAGGCAGG + Intergenic
1129678097 15:77643264-77643286 CTGTGTGGGCTGGACTAGGCAGG + Intronic
1130069496 15:80634619-80634641 CTGTGAGGGCACCAGGAGGCTGG + Intergenic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132366913 15:101264475-101264497 CTGTTTCTGCAGGAGGAAGCAGG - Intergenic
1132852761 16:2032350-2032372 CAGCATGGGCAGGAAGAGGTGGG + Intronic
1132882214 16:2167464-2167486 ACGTGTGGGCAGGAGGAGGGAGG + Intronic
1133128447 16:3662052-3662074 CTGCATGCGCAGGAAGTGGCGGG + Exonic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135294115 16:21264494-21264516 GTGTGGGGGCAGGAGGAGGGAGG + Intronic
1136090959 16:27919680-27919702 CTGTGTGGTCAGGGTGAGGCTGG - Intronic
1136590669 16:31216010-31216032 GTGCAGGGGCTGGAGGAGGCGGG + Exonic
1136619147 16:31416482-31416504 CTGAAGGGGAAGGACGAGGCTGG - Intronic
1136712643 16:32252954-32252976 CTCCATGGGCTGGAGGAGGTGGG + Exonic
1136755272 16:32676475-32676497 CTCCATGGGCTGGAGGAGGTGGG - Exonic
1136812841 16:33193894-33193916 CTCCATGGGCTGGAGGAGGTGGG + Exonic
1136819317 16:33303974-33303996 CTCCATGGGCTGGAGGAGGTGGG + Intronic
1136825880 16:33360509-33360531 CTCCATGGGCTGGAGGAGGTGGG + Exonic
1136830946 16:33459280-33459302 CTCCATGGGCTGGAGGAGGTGGG + Intergenic
1136932509 16:34432074-34432096 CCGTCTGGGCAGGCTGAGGCTGG - Intergenic
1136972063 16:34979740-34979762 CCGTCTGGGCAGGCTGAGGCTGG + Intergenic
1137253794 16:46758952-46758974 CTGTATGGCCAGGATGAGACAGG - Intronic
1137672575 16:50287944-50287966 CTGGATGCACAGGAGGATGCTGG + Exonic
1137753557 16:50884329-50884351 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753566 16:50884348-50884370 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753575 16:50884367-50884389 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753584 16:50884386-50884408 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1137753593 16:50884405-50884427 CGGGATGGGCTGGGGGAGGCGGG + Intergenic
1138008105 16:53355844-53355866 CGATAGGGGCAGGAGGAGGTAGG + Intergenic
1138455232 16:57117139-57117161 CCGCAGGGGCAGGAGAAGGCCGG + Intronic
1140261681 16:73385750-73385772 AGGTATGGGCAGGAGGGGCCTGG + Intergenic
1141946041 16:87310782-87310804 TAGTGTGGGAAGGAGGAGGCAGG + Intronic
1142065346 16:88059230-88059252 CTGTAAGGGCAGGTGGGGGTGGG + Intronic
1142128597 16:88422164-88422186 GTGGATGGGCAGGAGGATGGGGG + Intergenic
1142146406 16:88494651-88494673 CTGCACGGGCAGGAGGCCGCAGG + Intronic
1142156385 16:88534512-88534534 CAGTAGGGGCAGGCGGCGGCGGG - Exonic
1202991418 16_KI270728v1_random:16864-16886 CTCCATGGGCTGGAGGAGGTGGG + Intergenic
1203057415 16_KI270728v1_random:936814-936836 CTCCATGGGCTGGAGGAGGTGGG - Intergenic
1142878117 17:2864592-2864614 CGGTGTGGGGAGCAGGAGGCTGG + Intronic
1143178994 17:4972771-4972793 GTGTCTGGGCTGGAGGAGGGTGG + Exonic
1143329380 17:6122106-6122128 CTGCATTGGGAGGAGAAGGCAGG + Exonic
1144292604 17:13841080-13841102 CTGTATTGGGAGGCCGAGGCGGG + Intergenic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144702678 17:17349259-17349281 CTCCCTGGGCAGGAGGAGGGAGG - Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1146737976 17:35255850-35255872 CTGTTTGGGGAGGAAGAGGGTGG - Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1146912697 17:36658504-36658526 CTGGAAGGGGTGGAGGAGGCTGG + Intergenic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147131363 17:38411405-38411427 CTGTGTGTGGAGGATGAGGCAGG + Intergenic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1148057266 17:44807619-44807641 CTGTATGGGGAGGAGAAGACTGG - Intronic
1148094203 17:45041193-45041215 GTGAAGGGCCAGGAGGAGGCGGG - Intronic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148638476 17:49167266-49167288 CTGCATGGCCAGGAGGAAGAGGG + Intronic
1149640862 17:58201549-58201571 GGGTATGGGCAGGAGGGGTCTGG + Intronic
1151215611 17:72574792-72574814 CTCTATGGGCAGGAGGATATGGG - Intergenic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151827232 17:76530213-76530235 CTGAATGGAGAGGCGGAGGCAGG - Intronic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152370872 17:79887865-79887887 CTGTATTGGAAGGAGCAGGATGG - Intergenic
1152492851 17:80649420-80649442 GAGTTTGGGCAGGAGGAGGGAGG - Intronic
1152567428 17:81106550-81106572 CTTCATGGCCAGGAGGAGGAAGG + Intronic
1152574110 17:81132670-81132692 CTGTATCGGCAGGACCCGGCTGG - Intronic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1155060758 18:22226438-22226460 AAATATGGGAAGGAGGAGGCAGG + Intergenic
1155183458 18:23367866-23367888 CTGTATTGGGAGGCTGAGGCAGG - Intronic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157374709 18:47151923-47151945 CTGTCTGGGGAGGCTGAGGCAGG - Intronic
1157385505 18:47256832-47256854 CTATATGGGGAGGAGGTGGGTGG - Intergenic
1157560825 18:48644747-48644769 GAGTATGGGGAGGAGTAGGCTGG + Intronic
1157587455 18:48813848-48813870 GTGCAGGGGCAGGAGGAGACTGG - Intronic
1158196007 18:54885798-54885820 CTGTATGGGAAGCATGTGGCTGG + Intronic
1158569897 18:58589321-58589343 AGTTTTGGGCAGGAGGAGGCCGG + Intronic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160605589 18:80047261-80047283 CTTTTTGGGGAGGAGGTGGCAGG - Intronic
1160909089 19:1466590-1466612 CTGGAGGGGCTGGAGGAGGCCGG + Exonic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161978487 19:7618907-7618929 CTGTGTGGGCAGGAGGCAGCTGG - Intergenic
1161988097 19:7668936-7668958 CAGTAAGGGCTGGAGGAGGAAGG - Intergenic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162721627 19:12666269-12666291 TTGGAGGGGCAGGAGGTGGCAGG - Intronic
1163154710 19:15433369-15433391 CTAAGTGGGCAGGAGGGGGCGGG - Intronic
1163326139 19:16604525-16604547 CTGGATGTGCAGGCTGAGGCTGG + Intronic
1163441660 19:17325008-17325030 GTGACTGGGCAGGGGGAGGCCGG + Exonic
1164689674 19:30201250-30201272 CTGTATGGGTAGGAAGCAGCTGG + Intergenic
1164760256 19:30723113-30723135 ATGTCTGGCCAGGCGGAGGCAGG + Intergenic
1165373740 19:35426849-35426871 CAGGATGGGCAGGAGGGGGTGGG - Intergenic
1166067674 19:40369656-40369678 CTGGAGGGGCAGGAGGGGTCAGG + Intronic
1166197692 19:41217833-41217855 CAGTAGAGGCAGGAGAAGGCAGG + Intergenic
1166382389 19:42361866-42361888 CTGCATGGGCAGGAGGACCTGGG + Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167147795 19:47693629-47693651 CTGGATGGGCTGGTGGGGGCTGG + Intronic
1167458945 19:49614331-49614353 CTGGGTGGGCAGGAGGCGACAGG + Intronic
1167767015 19:51490336-51490358 CTGTGTGGGGAGAAAGAGGCCGG - Intronic
1167924921 19:52813583-52813605 CTGGAGGGACAGGAGCAGGCAGG - Intronic
1168659831 19:58157243-58157265 CTGTCTGGGCTGGTTGAGGCCGG + Intergenic
924959502 2:21363-21385 CTGCATGGGCGGCGGGAGGCTGG + Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925416643 2:3674705-3674727 CTGTCTGGGCAGGACCTGGCTGG + Intronic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926489180 2:13502908-13502930 CTGGATGGTCAGGAGGGGGGTGG - Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
928437038 2:31261429-31261451 AAGTAGGAGCAGGAGGAGGCGGG + Intronic
929115981 2:38444546-38444568 CTGTATGGGAAGGTTGAGGGAGG + Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929765726 2:44842743-44842765 CTGTGAGGGCAGGTGGATGCGGG + Intergenic
930909071 2:56608460-56608482 CATTATGGGCAGGAGGAAGAGGG - Intergenic
932813493 2:74843605-74843627 CTGAGTGGGCAGGAGGTGGGTGG - Intronic
933139753 2:78778935-78778957 CTCTTTGGGCTGGCGGAGGCCGG + Intergenic
933415772 2:81985118-81985140 CTGTCTGGGCTGGCTGAGGCCGG + Intergenic
933760237 2:85667595-85667617 CTGGATGGGCAGGAGGAGAGTGG - Intronic
933995827 2:87669065-87669087 TGGTAGAGGCAGGAGGAGGCAGG + Intergenic
935702571 2:105825093-105825115 CTGGAGGGAGAGGAGGAGGCAGG - Intronic
936019636 2:108984900-108984922 CTGCATGCACAGGAGGAAGCAGG - Intronic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936298030 2:111281847-111281869 TGGTAGAGGCAGGAGGAGGCAGG - Intergenic
936954869 2:118013757-118013779 CTGCATGGGCAGGGGGCGGCGGG - Intronic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
937380311 2:121370725-121370747 CTGCAGGGCCAGGAGGAGTCAGG - Intronic
937978496 2:127596582-127596604 CACTGTGGGCAGGAGTAGGCTGG - Intronic
938074825 2:128326138-128326160 AGGTATGGGCAGGGGCAGGCTGG - Intergenic
938118976 2:128620616-128620638 CTGTGAGGGCATTAGGAGGCAGG + Intergenic
938122178 2:128641800-128641822 CTGTGTGGGCAGGCAGAGGCTGG + Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941932026 2:170951437-170951459 CTGCATGGGGTGGAGAAGGCAGG + Exonic
942321681 2:174741715-174741737 CTGGATGGGGAAGAGGAGGCAGG - Intergenic
942959341 2:181811337-181811359 TTATGTGGGCAGGAGGAGGGGGG + Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
947463023 2:230319503-230319525 CTGGGTGGGGAGGAGGATGCAGG + Intergenic
947472002 2:230409271-230409293 CTGGATGGGGAGGAGGATGTAGG + Intergenic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
947948848 2:234130235-234130257 CTGTAAGGGAGGGAGGAAGCAGG - Intergenic
948201939 2:236135898-236135920 CTGGGAGGGCAGCAGGAGGCAGG - Intergenic
948217080 2:236239854-236239876 GTGTCTGTGCCGGAGGAGGCTGG + Intronic
948686967 2:239675879-239675901 CTGGAGGGGCAGGAGGCGGGGGG - Intergenic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
948853917 2:240721314-240721336 TGGCATGGGCAGGAGGCGGCAGG - Intronic
948938279 2:241182552-241182574 CTGAGTGGGAAGGAGGAGGGTGG + Intronic
1168771791 20:420652-420674 GGGGATGGGCAGGAGCAGGCAGG - Intronic
1168805977 20:672624-672646 CTGCAGGGTCAGGATGAGGCTGG - Intronic
1170718230 20:18850831-18850853 CTGTGTGGGCAGTTGGGGGCTGG - Intergenic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1171018666 20:21564302-21564324 CTGGATGGGTGGGAGGTGGCGGG + Intergenic
1172395708 20:34603015-34603037 AGATATGGGCAGGAGTAGGCTGG - Intronic
1172657125 20:36544061-36544083 CTGTATGGGACAGAAGAGGCCGG + Intronic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173886284 20:46462016-46462038 AGGTATGGGCAGGAGGGGTCTGG - Intergenic
1175161835 20:57013970-57013992 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1175185236 20:57175447-57175469 CTGCAGGGGCAAGAGGATGCGGG + Intronic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175419501 20:58822420-58822442 GTCTATGGACAGGAAGAGGCAGG + Intergenic
1175491596 20:59384080-59384102 GTGAATGGGCAGGAGGTGACTGG + Intergenic
1175970691 20:62685234-62685256 GTGTGGGGGCAGGAGGAGGGGGG + Intronic
1176069932 20:63220923-63220945 GTGGATGGACAGCAGGAGGCAGG + Intergenic
1176121118 20:63455023-63455045 CTGCCTGGGCAGGAGGGGGCGGG - Intronic
1177767628 21:25476165-25476187 CTGTATAGGCAGCATGATGCTGG - Intergenic
1178960469 21:37060126-37060148 CTGCATGCTCAGGAGGTGGCAGG - Intronic
1179585026 21:42369358-42369380 CTGTCTAGGAAGGAGGAAGCAGG + Intergenic
1179730025 21:43362490-43362512 CTGCCTGGGCGGGAGGAGGTGGG - Intergenic
1179926832 21:44539369-44539391 CTGGCCTGGCAGGAGGAGGCAGG + Exonic
1179931673 21:44574905-44574927 CTGGGTTGGCAGGAGGAGGTGGG - Exonic
1179937077 21:44612791-44612813 CTGGGCTGGCAGGAGGAGGCAGG - Exonic
1179942142 21:44647233-44647255 CTGGACTGGCAGGAGGAGGTGGG - Exonic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180847049 22:18989213-18989235 CTGTCTGGGTCGGGGGAGGCAGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183322828 22:37175685-37175707 CTGCCTGGGAAGGAGGAGACAGG - Intergenic
1183356286 22:37361512-37361534 GTGTCTGGGCAGGAGCAGGGTGG - Intergenic
1183456189 22:37924609-37924631 CTTCATGGGCAGCAGGAGGTGGG - Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183936516 22:41265526-41265548 CTGTTCGTGCAGGAGGAGGGAGG + Intronic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184325739 22:43782935-43782957 CTGTTGGGGCAGGGGGAGGCAGG - Intronic
1184815815 22:46868923-46868945 CTGTGTGGGTAGGAGTAGGTGGG + Intronic
1185005917 22:48276997-48277019 GAGGATGGGCTGGAGGAGGCAGG - Intergenic
1185029818 22:48436345-48436367 CTGCATGGGCAGGAAGAGTGAGG - Intergenic
1185161078 22:49230252-49230274 CTGAGTGGGCAGGGGGACGCTGG - Intergenic
949152888 3:791695-791717 CTGTCTGGGGCGGAGGAGGGTGG + Intergenic
949168003 3:963742-963764 GGGTATTGGCAGGAGGAAGCTGG + Intergenic
949518351 3:4827179-4827201 CTGTCGGGGCAGGAGCAGGAGGG - Intronic
950528113 3:13536367-13536389 CTGTCTGTGATGGAGGAGGCCGG + Intergenic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
950702881 3:14762181-14762203 CTGTGTGGGGAGGCTGAGGCAGG - Intronic
951502050 3:23399440-23399462 CTGTATGGGCTGGAGTAGGGTGG + Intronic
951690215 3:25387244-25387266 CTGGATGGACAGGAGGACACTGG + Intronic
951724249 3:25738738-25738760 CTATATGGGGAGGCTGAGGCAGG - Intronic
951922893 3:27875320-27875342 CTATTTGGGGAGGAGGGGGCAGG - Intergenic
951979284 3:28547971-28547993 ATGCATGGGCAGGAGGAGAATGG + Intergenic
952750014 3:36817425-36817447 CTGTATGTGCTGGAGGAGGTAGG - Intergenic
952761376 3:36917437-36917459 CAGCAGGGGAAGGAGGAGGCAGG + Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953027283 3:39152567-39152589 CTGGGTGGGCAGCAGGAGACGGG + Intronic
953040834 3:39253548-39253570 TTTCCTGGGCAGGAGGAGGCAGG + Intergenic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953271389 3:41448641-41448663 CTGTAAGGGCAGGAGGATGGTGG + Intronic
953877530 3:46674850-46674872 TTTTCTGGGGAGGAGGAGGCTGG - Intronic
953917807 3:46931690-46931712 CTGTATGGCCAGGAGGGACCAGG - Intronic
953999863 3:47547509-47547531 CTGGATGTGGAGGCGGAGGCAGG - Intergenic
954110375 3:48429854-48429876 CTGGACGGGCGGGAAGAGGCCGG - Intronic
954377956 3:50204841-50204863 CTGGTTGGGAAGGGGGAGGCAGG + Intergenic
955705243 3:61720677-61720699 CTGTATGTGCAGGATATGGCAGG + Intronic
956094639 3:65703136-65703158 CTGTTTTGGCAGGGGGTGGCTGG + Intronic
959633070 3:108531092-108531114 CTGAATGGGTAGCAGGATGCAGG + Intergenic
961721393 3:128899058-128899080 ATGGATGGCCAGGTGGAGGCGGG - Intronic
961905561 3:130259608-130259630 CTGTGTGGGCAGGAACAAGCAGG - Intergenic
962264349 3:133934829-133934851 ACCTGTGGGCAGGAGGAGGCAGG + Exonic
962327671 3:134449456-134449478 CTGAATGGACAGCAGGGGGCAGG - Intergenic
962772699 3:138627939-138627961 CTGTATGTGCACAAGGAGTCTGG - Intronic
964376212 3:156051721-156051743 CTCTCTGGGCTGGTGGAGGCTGG + Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
964847567 3:161060320-161060342 ATGTATGGGCAACAGGAGGGAGG + Intronic
966732530 3:183162815-183162837 CCGTAGGGGTAGGAGGGGGCCGG - Exonic
966734311 3:183176772-183176794 CTGAATGGGCATCAGCAGGCTGG - Intergenic
966881393 3:184353148-184353170 CTGCATAGGCAGGAAGGGGCTGG + Intronic
967920448 3:194610267-194610289 ATGAAAGGGCTGGAGGAGGCAGG - Intronic
967980107 3:195060615-195060637 GTGGCTCGGCAGGAGGAGGCAGG - Intergenic
968530869 4:1090898-1090920 TTGTTGGGGGAGGAGGAGGCTGG + Intronic
968547506 4:1206401-1206423 CTGCCAGGGCAGGGGGAGGCCGG + Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968720249 4:2197231-2197253 CTGAAGGGGCAGGTGGAAGCAGG + Intronic
968751048 4:2389213-2389235 CTGTGTGGGCAGGACCTGGCTGG - Intronic
968908300 4:3464389-3464411 CTGCAAGGGGAGGCGGAGGCAGG - Intronic
969409603 4:7019495-7019517 CTTTATGGGCATGTGGAGGAGGG + Intronic
969513083 4:7630829-7630851 CTGTCTGGCCAGGAGTAGACTGG + Intronic
969670163 4:8585792-8585814 CGGGATGGGGATGAGGAGGCTGG - Intronic
971287745 4:25306740-25306762 CTGTATGAGCAGGCTGAGGCTGG + Intergenic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
973786504 4:54337448-54337470 CAGAAGGGGCTGGAGGAGGCAGG - Intergenic
974186746 4:58456875-58456897 CTCTCTGGGCTGGTGGAGGCTGG + Intergenic
974187966 4:58465065-58465087 CTCTCTGGGCTGGTGGAGGCTGG + Intergenic
977331321 4:95641108-95641130 ATCTATGGGCTGGAGGAGGAGGG - Intergenic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978852160 4:113352096-113352118 ACGTATGGGCAGGAGGATGGCGG - Intronic
981127257 4:141120896-141120918 CTGTATGGGCAGCAGATGGCAGG + Intronic
982068025 4:151671814-151671836 CTGTGTGGGCAGGGGGAGTGAGG + Intronic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
982724451 4:158890806-158890828 CTGTCTGGGCAGGAATATGCTGG + Intronic
985280312 4:188280014-188280036 AAGTCTGGGCAGGAGGAAGCGGG + Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985507868 5:294792-294814 GTCCATCGGCAGGAGGAGGCGGG + Intronic
985572150 5:652794-652816 GTGGTTGGGAAGGAGGAGGCAGG + Intronic
985639183 5:1055599-1055621 CTGTAGGGTCAGGAGAAGGTGGG - Intronic
985646908 5:1089225-1089247 CCGTGGGGGCAGGAGGGGGCAGG + Intronic
985740168 5:1610879-1610901 GTCCATCGGCAGGAGGAGGCGGG - Intergenic
985956527 5:3269880-3269902 CTTCATGGGGAGGAGGTGGCCGG - Intergenic
985972518 5:3389597-3389619 CTGTATGCGTAGGAGGTTGCAGG + Intergenic
985992873 5:3577919-3577941 CAGTTTGGACAGGTGGAGGCTGG - Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987103725 5:14616498-14616520 CTGTATTGGCAGGAGGTCCCTGG + Intergenic
987292879 5:16524933-16524955 CTGCAGGGGCTGGAGGACGCAGG - Intronic
987292912 5:16525089-16525111 CTGCAGGGGCTGGAGGATGCAGG - Intronic
987383343 5:17306621-17306643 CAGTCTGGGCAGGAGGCAGCAGG - Intergenic
990020577 5:51122074-51122096 CCGTATTTGCAGGAGGAGCCTGG + Intergenic
991964932 5:72081478-72081500 CTGTAGGGGGAAGTGGAGGCAGG + Intergenic
993338572 5:86692876-86692898 CAGTATGGGGAGGCTGAGGCAGG - Intergenic
994210833 5:97085649-97085671 CTGTCTGGGCTGGCCGAGGCTGG - Intergenic
995021748 5:107374384-107374406 CTGTTTGGAAAGGAGGAGGTGGG + Intergenic
995553084 5:113299773-113299795 AGGTGTGGGCAGGAGGTGGCAGG + Intronic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
996870850 5:128191764-128191786 CAGTTTGGGAAGGAGGTGGCTGG + Intergenic
997822594 5:137079316-137079338 ATGCATGGGCAGGAGGATGGAGG + Intronic
999241025 5:150127422-150127444 ATGGATGGGGAGGAGGAGGTGGG - Intronic
999380510 5:151117930-151117952 CAGTATTGGCAGGGGGAGGTGGG + Intronic
999475192 5:151891794-151891816 CTGTTTGGGGAGGAGCAGGGTGG + Intronic
999907994 5:156164526-156164548 CAGCATGGGCAGGAGCAGACTGG - Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002681658 5:180969793-180969815 CTGTCTGGGCTGGCCGAGGCTGG - Intergenic
1002719125 5:181247148-181247170 CTGGATGAGAAGGAAGAGGCCGG - Intronic
1002793157 6:449930-449952 CTCTCTGGGCTGGCGGAGGCCGG + Intergenic
1003408168 6:5840111-5840133 CTGTTTGGGCAGCAGTAGCCGGG - Intergenic
1003616197 6:7657364-7657386 CTGTGTGGGCTGGAGGGGTCTGG + Intergenic
1004288727 6:14347191-14347213 AGGGATGGGCACGAGGAGGCTGG - Intergenic
1004581290 6:16956047-16956069 CTGTATGTGTAGGTGGAGGGAGG + Intergenic
1004830325 6:19470233-19470255 GTGAATGGGCAGGAGTAGGCAGG - Intergenic
1005042610 6:21612790-21612812 CTGTATCTAAAGGAGGAGGCTGG - Intergenic
1005276983 6:24229955-24229977 CTGTGTGGCCAAGAGCAGGCTGG - Intronic
1005400170 6:25423895-25423917 ATTTATGGGCAGGAAGAGGCAGG - Intronic
1006056703 6:31390577-31390599 CTGCATGGGCACTAGGAGGATGG - Intergenic
1006069423 6:31487492-31487514 CTGCATGGGCACTAGGAGGATGG - Intergenic
1006286009 6:33094876-33094898 AAGGATGGGCTGGAGGAGGCGGG + Intergenic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006730308 6:36231262-36231284 CTGTCTGGGCCTGAGGAGCCTGG - Exonic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006939469 6:37742449-37742471 TGGTTTGGGCAAGAGGAGGCAGG - Intergenic
1007109556 6:39304992-39305014 CTGGATGGGCAGATGGATGCTGG + Intronic
1007271516 6:40640974-40640996 CTGCTTGGGGAGGAGGTGGCAGG + Intergenic
1010348359 6:74840297-74840319 CTGTATAGGGAGCATGAGGCTGG - Intergenic
1010648016 6:78416920-78416942 CTGTATAGGCAAGAGCAGACTGG + Intergenic
1011586659 6:88933403-88933425 GTGTGTGGGCAGGAGGAGCATGG - Intronic
1011921797 6:92586658-92586680 CTGTAAGGGCAGGAGTGGGAGGG + Intergenic
1012408187 6:98924843-98924865 CTGCCAGTGCAGGAGGAGGCGGG - Intronic
1013316384 6:108947140-108947162 CGGCATGGGCAGGAGGGAGCTGG + Intronic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1016934078 6:149436107-149436129 CAGTAGGGGCTGGGGGAGGCCGG + Intergenic
1016965897 6:149718268-149718290 TCGTATGGGCAGGGGCAGGCGGG - Intergenic
1016984782 6:149887079-149887101 CTGTCTGGGCAGGAGCAGGCAGG - Intronic
1017746880 6:157455196-157455218 CTGCATGGGCAGGAGGACCCAGG + Intronic
1018038656 6:159903088-159903110 CTGAAGGGGAAGGAGGAGGTGGG - Intergenic
1018188209 6:161286377-161286399 CTGTGAGGGACGGAGGAGGCTGG + Intergenic
1018351426 6:162963165-162963187 TTGTTTGGGCAGGTGAAGGCAGG + Intronic
1018792856 6:167162688-167162710 ATGTATGGGCAGGAGGGGTATGG + Intronic
1018890023 6:167976663-167976685 CTGTGCGGGGAGGAGGAGGCAGG + Intergenic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019079384 6:169419817-169419839 CTGTGCGGGGAGGAGGAGGTGGG + Intergenic
1019080197 6:169425104-169425126 ATCTGTGCGCAGGAGGAGGCTGG + Intergenic
1019184376 6:170212603-170212625 CTGGAGGTGCGGGAGGAGGCAGG - Intergenic
1020527573 7:9282088-9282110 CTGTATAGGAAGCAGGATGCTGG + Intergenic
1021546779 7:21822321-21822343 GAGAATGGGCAGGAGGAGCCAGG + Intronic
1021656631 7:22880207-22880229 CAGGATGGGCAAGAGGAAGCAGG - Intergenic
1021982087 7:26064996-26065018 CTGTGTGGGGAAGGGGAGGCTGG - Intergenic
1022481133 7:30743903-30743925 CTGCAGGGGCTGGAGGTGGCTGG - Intronic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026400955 7:70012235-70012257 CAGGATTGGCTGGAGGAGGCAGG + Intronic
1026913207 7:74104789-74104811 CTGCATTGGCAGGAGGGAGCTGG - Intronic
1027144327 7:75683526-75683548 CTGGAGGGGCAGGAGGAAGCTGG + Intronic
1030064850 7:105651784-105651806 ATGTTTGTGCATGAGGAGGCTGG - Intronic
1030188822 7:106790725-106790747 CTCTAGGAGGAGGAGGAGGCTGG - Intergenic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031974908 7:128087407-128087429 CTGTATAGGCAGGAGGAATGTGG + Intronic
1032019153 7:128396887-128396909 TTGGAGGGGCAGGAGCAGGCGGG + Intronic
1034497869 7:151432989-151433011 CCGTGAGGGCAGGAGGGGGCAGG - Intronic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1036033163 8:4993811-4993833 GTGTATGGGTGCGAGGAGGCCGG + Intronic
1036512948 8:9417543-9417565 CTGAAGGGCCAGCAGGAGGCTGG - Intergenic
1037583679 8:20261894-20261916 CTGAGTGGGAGGGAGGAGGCAGG - Intronic
1038038008 8:23702653-23702675 CTGTAGGGGCTGGGGAAGGCAGG + Exonic
1039256901 8:35729036-35729058 ATGTTTGGGCAGGAGGAGTGGGG + Intronic
1040896057 8:52369512-52369534 CTGTCTGGGCATAAGTAGGCTGG - Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041318911 8:56593712-56593734 GAGTGTGGGCTGGAGGAGGCAGG + Intergenic
1041697149 8:60748105-60748127 CTGTGTGAGCAGGAAGATGCAGG + Intronic
1042560507 8:70069954-70069976 CTGGCTGGGGTGGAGGAGGCTGG - Intronic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1044752082 8:95426100-95426122 CTGAATTGGCTGGAGGAAGCAGG + Intergenic
1044832934 8:96267878-96267900 ATGTGTGGGCAGGAGGTGGCGGG - Intronic
1044963867 8:97556858-97556880 CTCTCTGGGCAGGCTGAGGCCGG + Intergenic
1045027276 8:98099398-98099420 CTGTATCGGGAGGCTGAGGCAGG + Intergenic
1048329952 8:133464646-133464668 TTGTGTGTGCCGGAGGAGGCTGG + Intronic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049795584 8:144495993-144496015 CAGTCAGGACAGGAGGAGGCGGG + Intronic
1050216930 9:3337075-3337097 CCTTATGGGTAGGAGGAGGTAGG + Intronic
1050328696 9:4523071-4523093 AGGGATGGGGAGGAGGAGGCTGG - Intronic
1050424518 9:5500024-5500046 AGGTATGGGCAGGAGGGGTCTGG + Intergenic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1050874943 9:10622755-10622777 CTGTATAGGAAGCATGAGGCTGG + Intergenic
1053419954 9:37970996-37971018 CTGTATGGGGTGGAGTTGGCTGG - Intronic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1056976251 9:91257453-91257475 CTGTTGGGGTGGGAGGAGGCTGG - Intronic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057608666 9:96520903-96520925 CTGGATGTGGTGGAGGAGGCAGG - Intronic
1058414158 9:104767883-104767905 CTGTATTTGCAGGAGGTTGCAGG + Intronic
1058652924 9:107193933-107193955 CTGTATGGGAAGCATGATGCTGG - Intergenic
1060089657 9:120731742-120731764 CTGAATGAGAACGAGGAGGCAGG + Intergenic
1060198198 9:121636601-121636623 AAGTCTGGGCAGGAGGTGGCTGG + Intronic
1060481988 9:124021901-124021923 CTGGGTGGGCAGGTGGGGGCGGG + Intronic
1060857523 9:126926791-126926813 GTGGATGGGGAGGAGAAGGCAGG + Intronic
1061498406 9:130989001-130989023 CAGGAAGGGCAGGAGGTGGCTGG - Intergenic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1062350992 9:136138504-136138526 CTGGATGGGGAGGAGGATGTGGG + Intergenic
1062722687 9:138052764-138052786 CTGTATGTGAAGGAGTGGGCTGG + Intronic
1185932881 X:4222489-4222511 CTGTATCGGGAGGCTGAGGCGGG - Intergenic
1189491270 X:41473375-41473397 CTGTCCGGGCAGCAGGATGCAGG - Intronic
1190262808 X:48808360-48808382 CTGTAAGGGTGGGAGGTGGCTGG - Intronic
1194141496 X:90215775-90215797 AGGTATGGGCAGGAGGGGTCTGG + Intergenic
1195060757 X:101191639-101191661 CTGCCCGGGCGGGAGGAGGCGGG + Intergenic
1195112123 X:101659118-101659140 CTGTGTGGGCCGGAGGTGTCTGG + Exonic
1195255899 X:103090671-103090693 CTTTTGGGGCAGGGGGAGGCGGG + Intronic
1195258991 X:103114883-103114905 CTGGATGGGAAGGAGGAGACAGG - Intergenic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196792867 X:119480093-119480115 GAGTATGGGCAGGTGGAGTCTGG - Intergenic
1197312356 X:124920630-124920652 CTGTAAGGGTATGAGGAAGCTGG - Intronic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197860622 X:130966224-130966246 CTGAGTTGGCAGTAGGAGGCTGG - Intergenic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1200487248 Y:3784879-3784901 AGGTATGGGCAGGAGGGGTCTGG + Intergenic