ID: 1091606282

View in Genome Browser
Species Human (GRCh38)
Location 12:1954676-1954698
Sequence CAGAGCTAGCACTGTAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091606282_1091606285 -8 Left 1091606282 12:1954676-1954698 CCCAGTCTACAGTGCTAGCTCTG 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1091606285 12:1954691-1954713 TAGCTCTGCATCTGGCACAGAGG 0: 1
1: 0
2: 7
3: 26
4: 256
1091606282_1091606286 -5 Left 1091606282 12:1954676-1954698 CCCAGTCTACAGTGCTAGCTCTG 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1091606286 12:1954694-1954716 CTCTGCATCTGGCACAGAGGAGG 0: 1
1: 0
2: 4
3: 46
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091606282 Original CRISPR CAGAGCTAGCACTGTAGACT GGG (reversed) Intronic
901449042 1:9325124-9325146 CTGTGCTCTCACTGTAGACTGGG + Intronic
901774444 1:11550440-11550462 CAGAGGTACCACTGCAGACTAGG + Intergenic
902435503 1:16395916-16395938 CTGGGCTAGCTCTGTAGGCTCGG + Exonic
902825807 1:18973419-18973441 CTGAGCTAGCACATTAGGCTGGG - Intergenic
904849369 1:33445927-33445949 CAGAGCTAGCCCTGCAGCCATGG - Intergenic
910015842 1:82522195-82522217 CAGTTCTTGCACTGTAGTCTGGG - Intergenic
918039651 1:180906162-180906184 CAGAGCAAGCATGGTAGACTAGG + Intergenic
921679706 1:218016052-218016074 CAGAGCCCGCACTGAATACTGGG - Intergenic
1062856121 10:780291-780313 CAGACCCTGCACTGTAGACCCGG - Intergenic
1062856190 10:780638-780660 CAGACCCTGCACTGTAGACCCGG - Intergenic
1062856197 10:780673-780695 CAGACCTTGCACTATAGACCTGG - Intergenic
1062856216 10:780743-780765 CAGACCCTGCACTGTAGACCTGG - Intergenic
1062856226 10:780778-780800 CAGACCCTGCACTGTAGACCTGG - Intergenic
1062856246 10:780848-780870 CAGACCCTGCACTGTAGACCTGG - Intergenic
1064262763 10:13799104-13799126 GAGAGCAAGTTCTGTAGACTGGG - Intronic
1065590228 10:27256245-27256267 CAGAGATAGCACTCCAGCCTAGG + Intergenic
1066522342 10:36236050-36236072 CAGAGTTAGCACTGGAGAAACGG - Intergenic
1068789161 10:61008651-61008673 CACAGCTAGCACAGCAGTCTAGG - Intergenic
1068856479 10:61803069-61803091 CAAAGCTAGCACTCTGGACCTGG + Intergenic
1069815005 10:71188234-71188256 CACAGCTACCACTCTGGACTTGG - Intergenic
1070500794 10:77070822-77070844 CAAAGATAGCAATGTAGAATGGG + Intronic
1070618039 10:77984408-77984430 CAGAGCTTGCTCAGTAAACTGGG - Intronic
1073938239 10:108660996-108661018 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
1075941976 10:126397537-126397559 CAGAGCTAGCAATCTGTACTGGG + Intergenic
1076581541 10:131515526-131515548 CTGAGCTATCTCTGCAGACTCGG + Intergenic
1078928720 11:15896794-15896816 CAGGGCTAGCATTGGAGCCTAGG - Intergenic
1079864275 11:25715898-25715920 CAGAGCTGGCACTGCAAACCTGG + Intergenic
1079930719 11:26556806-26556828 CAGAGCTATTACTGGAGACTTGG - Intronic
1081614778 11:44584259-44584281 CAGAGCTGGGACTGAAGCCTAGG + Intronic
1082014193 11:47472079-47472101 CACAGCTTGCCCTGAAGACTCGG - Intronic
1083305076 11:61757867-61757889 CAGAGCTGGGACTGGAGCCTGGG + Intronic
1083786099 11:64948453-64948475 CAGAGCTAGCTCTGTTGCCCAGG + Intronic
1084116048 11:67043533-67043555 CAGAGCCAGGACTCTAGCCTGGG + Intronic
1086020800 11:82227252-82227274 GAGAGCTAGCCTTGTAAACTAGG + Intergenic
1086974061 11:93113197-93113219 CAGAACTGGCCCTGTAGCCTGGG - Intergenic
1088589071 11:111386973-111386995 CAGTGCTAGCAGTGTGGCCTTGG + Intronic
1089005679 11:115088863-115088885 CAGAGGTTGCATTGTAGCCTGGG - Intergenic
1089848276 11:121475602-121475624 CAGTGCTTGGCCTGTAGACTTGG + Intronic
1090259905 11:125312037-125312059 CAGATCCAGCACTTTAGATTGGG + Intronic
1090262928 11:125334515-125334537 CAGAGCTAGAATTGGAGTCTAGG - Intronic
1091219793 11:133923472-133923494 CATAACGAGCTCTGTAGACTTGG - Intronic
1091606282 12:1954676-1954698 CAGAGCTAGCACTGTAGACTGGG - Intronic
1091646470 12:2275757-2275779 GACAGCCAGCACTGTAGAGTGGG + Intronic
1093997087 12:25654402-25654424 CAGAGCTTACACTGTAGGGTTGG + Intergenic
1096446096 12:51693474-51693496 AAGAGCTATCACTGTAGGCTGGG + Intronic
1098774928 12:74600571-74600593 GACAGCTTGCACTGTGGACTTGG + Intergenic
1100521269 12:95378468-95378490 CAGAGCTTGCACTCCAGCCTGGG - Intronic
1103196049 12:119044592-119044614 CAGACCCAGCTGTGTAGACTTGG + Intronic
1111271790 13:85896158-85896180 CAGAGCAAGCACTCCAAACTCGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1114229109 14:20764416-20764438 CAGAGCTAGCACTGGAGAAGTGG - Intergenic
1114296703 14:21335762-21335784 CAGAGCTTGCACTCCAGCCTGGG + Intronic
1115102622 14:29721163-29721185 GAGAGCTGGCACTGTAGTCCAGG - Intronic
1117224122 14:53637521-53637543 AAGACCTAGCTCTGTAAACTGGG - Intergenic
1118598564 14:67454914-67454936 CAGAGGTTGCACTCTAGCCTGGG - Intronic
1119855551 14:77897876-77897898 CAGAGCAAGGGCTGTAGAGTTGG + Intronic
1121568902 14:94931682-94931704 CTGAGCTTGCACTGCAGACCAGG - Intergenic
1202831669 14_GL000009v2_random:41310-41332 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1124362416 15:29047348-29047370 CAGCGCTAGCATTGTAGTCATGG + Intronic
1125326606 15:38541686-38541708 CAGAGCTGGCATCCTAGACTTGG + Intronic
1125474838 15:40040017-40040039 CAGAGGTAGAACTAAAGACTGGG - Intergenic
1125767037 15:42142788-42142810 CAGAGCTGGCATTGAAGCCTGGG - Intronic
1126675458 15:51156388-51156410 CAGACCCAGCATTGTAGACAAGG - Intergenic
1126746255 15:51829356-51829378 CAGGGCTTGCATTGTAGCCTTGG - Intergenic
1127643761 15:60939746-60939768 CAGGGCTAGCACAGCCGACTTGG - Intronic
1127801482 15:62480945-62480967 CAGAGCTAGCACTATTGACAGGG + Intronic
1130840391 15:87694434-87694456 CAGAGCGAGCACTGTAGCCATGG - Intergenic
1132188427 15:99826226-99826248 AAGAGATAGGACTGGAGACTTGG + Intergenic
1135784813 16:25339381-25339403 CAGAGCTTTCAGTCTAGACTGGG + Intergenic
1136605255 16:31329613-31329635 GAGAGCTAGGACTGGAGACCAGG + Intronic
1141013921 16:80429637-80429659 CAGAGACAGCACTGTAAAATCGG - Intergenic
1144518752 17:15940264-15940286 CAGAGCTGCCTCTGAAGACTTGG + Intergenic
1145176154 17:20702231-20702253 AAGAACAAGCACTGTAGGCTGGG + Intergenic
1147655922 17:42091027-42091049 GAGAGCTAGGACAGTAGGCTGGG + Intergenic
1148522504 17:48293595-48293617 CTGAGTTAGCACTGTGGAATTGG + Intronic
1151513733 17:74578904-74578926 CAGAGCTAGAACTGTGAGCTGGG - Intergenic
1151696912 17:75722448-75722470 CAGAGCTGGCAGTGAAGGCTTGG + Intronic
1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG + Intronic
1153952563 18:10069499-10069521 CACAGTTTGCACTGTAGAATTGG + Intergenic
1154421326 18:14231290-14231312 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1155838318 18:30614927-30614949 CCGAGATTGCACTGTAGCCTTGG - Intergenic
1155879910 18:31132387-31132409 CAGCCCTAGCCCTGTAGAATTGG + Intronic
1157697991 18:49738947-49738969 CAGAGCAAGCACTGGAGCCCTGG + Intergenic
1158222105 18:55160557-55160579 GAGAGCTTGCAATGTACACTTGG + Intergenic
1160922554 19:1527869-1527891 CAGAGCTACCCCTGCACACTTGG - Intronic
1162605436 19:11703486-11703508 AAAAGCTAGCATTTTAGACTTGG + Intergenic
1164487299 19:28669744-28669766 AAGAGAAGGCACTGTAGACTGGG + Intergenic
1164960331 19:32423262-32423284 CAGAGCTCGCTCTGTCGCCTAGG + Intronic
1165169484 19:33881425-33881447 GAGACCTATCACTGTGGACTGGG + Intergenic
1168699590 19:58429000-58429022 CAGAGCTAGCTCTGAAGAATGGG - Intergenic
1202641027 1_KI270706v1_random:86444-86466 CAGAGCTGGAAATGTAGATTAGG - Intergenic
925255009 2:2475866-2475888 CAGAGCTGGCACTGTACCCTGGG + Intergenic
925578450 2:5384938-5384960 CAGAGCTTACACTGGAGACTTGG + Intergenic
927724353 2:25409839-25409861 CAGGGCTAGCAATGTAGACTTGG - Intronic
928593556 2:32840220-32840242 CAGAGCTGACACTGCTGACTGGG + Intergenic
930257946 2:49113200-49113222 CAGAACTAGCTCTGGGGACTTGG - Intronic
934496826 2:94809862-94809884 CAGAGCTAGAAATGTAGATTAGG - Intergenic
935333114 2:101991814-101991836 CAGACCCAGCACTGCAGCCTGGG + Intergenic
935821388 2:106896469-106896491 CAGAGCTAGCACTGATCATTCGG - Intergenic
937219367 2:120332972-120332994 AAGAGCTATCACAGTAGAGTGGG - Intergenic
937716705 2:125040020-125040042 CTGGGCTTGCACTGGAGACTGGG + Intergenic
938710421 2:133971790-133971812 CAGATCTAGATCTGTAGCCTAGG - Intergenic
938715253 2:134013803-134013825 CAAAGAGAGCACTGTAAACTTGG - Intergenic
940895660 2:159080165-159080187 CTGGGCTAGCTCTGTAGGCTCGG + Intronic
942228514 2:173837802-173837824 CAGTGTTAGCACTGTAAACCAGG + Intergenic
946343710 2:219090620-219090642 CAGACCTAGTGCTGTTGACTGGG - Intronic
1169641855 20:7761066-7761088 CAGAGCTAGCAAAGAAGACAGGG - Intergenic
1170687044 20:18578748-18578770 CAGAGCTAGCACAGAAGCCGTGG + Intronic
1170819227 20:19742097-19742119 CAGTGAGATCACTGTAGACTGGG - Intergenic
1172381431 20:34496029-34496051 CAGAGGTTGCACTCTAGCCTGGG + Intronic
1175251271 20:57611550-57611572 TAAAGCTAGCACTCTAGGCTGGG - Intronic
1176610857 21:8886143-8886165 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1179181544 21:39049481-39049503 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
1180360928 22:11895428-11895450 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1181367840 22:22392331-22392353 CATGGGTAGAACTGTAGACTCGG - Intergenic
951344755 3:21534263-21534285 CTGAACTTGCATTGTAGACTAGG + Intronic
951421507 3:22491392-22491414 CAGAACAAGCACTGTTAACTGGG + Intergenic
951998130 3:28754483-28754505 CAGAGCTAGGTTTGGAGACTAGG - Intergenic
957046382 3:75378316-75378338 CAGAGATGGCACTGGGGACTTGG - Intergenic
960101135 3:113745355-113745377 GAGCGCGATCACTGTAGACTTGG - Intronic
961555536 3:127694489-127694511 CAGAGCTAGCTCTGCAGACAGGG - Intronic
967546410 3:190734174-190734196 GAGAGCTAGCACTTTTGATTAGG - Intergenic
967945165 3:194798358-194798380 CAGAGCCAACCCTGTAGCCTAGG + Intergenic
968351307 3:198055627-198055649 CAGAGCTGGAAATGTAGATTAGG - Intergenic
1202737538 3_GL000221v1_random:20946-20968 CAGAGCTGGAAATGTAGATTAGG + Intergenic
968982402 4:3857344-3857366 CAGGGCTACCACTGTATACTAGG + Intergenic
969485078 4:7467671-7467693 CAGAGCTGGGACTGGAGCCTAGG - Intronic
970360912 4:15308155-15308177 AACAGCTTGCACTGTACACTTGG - Intergenic
971758378 4:30732727-30732749 GAGAACCAGCACTCTAGACTGGG + Exonic
972092337 4:35302639-35302661 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
973384542 4:49496974-49496996 CAGAGCTGGAAATGTAGATTAGG - Intergenic
973661909 4:53116796-53116818 CAGAGCTAGCACAGTAATTTGGG + Intronic
974096271 4:57367899-57367921 CAGAGCTAGCTTAGTAGCCTTGG + Intergenic
975983595 4:80184258-80184280 CAGAGCCAGCCCTGTAGCCCCGG - Intronic
977241967 4:94582998-94583020 CAGAGTTAGAACTGTAGTTTGGG + Intronic
979984331 4:127295689-127295711 GACAGCTTGCACTGTACACTTGG - Intergenic
980744900 4:137000814-137000836 CAGAGCAAGCACTGAAAATTGGG - Intergenic
983648223 4:170013465-170013487 CAGAACTAGAACATTAGACTTGG + Intronic
984330257 4:178306360-178306382 CAGACCTAGCACTGTTAACCTGG + Intergenic
1202768394 4_GL000008v2_random:172295-172317 CAGAGCTGGAAATGTAGATTAGG - Intergenic
988579754 5:32458679-32458701 CAAAGCTTGCACTGTACACCTGG - Intergenic
988768050 5:34403276-34403298 CACAGCTAGCACTGTGCAGTTGG - Intergenic
993526268 5:88969557-88969579 ATGAGCTAGCCCTGTTGACTTGG - Intergenic
994314001 5:98310774-98310796 CAGATCTGGCATTGTACACTGGG - Intergenic
995591310 5:113702667-113702689 CAGTGCTGTAACTGTAGACTTGG + Intergenic
995881872 5:116852285-116852307 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
996863789 5:128094443-128094465 CAGAGCTAGCATTGGAAATTGGG + Intronic
1003978489 6:11366749-11366771 CACAGCTAGGACTGAAGCCTGGG - Intronic
1005035847 6:21554321-21554343 CCGAGCTAGAGCTATAGACTTGG + Intergenic
1006699301 6:35958777-35958799 CAGAGTGAGTGCTGTAGACTAGG + Intronic
1007187424 6:39984184-39984206 CAGAGCTAGAACTGAGGAATAGG - Intergenic
1007535108 6:42580187-42580209 CAGAGAGAGCAGTGTAGACAAGG - Intronic
1007775970 6:44224471-44224493 CTCAGTTAGCCCTGTAGACTGGG - Intronic
1008543203 6:52563650-52563672 CAGAGCTTGCACTCCAGCCTGGG + Intronic
1011744761 6:90398824-90398846 CAGAGCTAGCACTGGAGTGCAGG - Intergenic
1014899961 6:126951320-126951342 AGGTGATAGCACTGTAGACTTGG - Intergenic
1015404888 6:132825940-132825962 CAGAGGTTGCACTGCAGCCTGGG + Intergenic
1024145887 7:46515919-46515941 CAGAGGTAGCTCTGCAGACAGGG - Intergenic
1024994452 7:55261413-55261435 CAGACCAGTCACTGTAGACTCGG + Intergenic
1025639108 7:63350600-63350622 CAGACTTAGCACTGTGAACTGGG + Intergenic
1025643591 7:63397492-63397514 CAGACTTAGCACTGTGAACTGGG - Intergenic
1025713178 7:63930524-63930546 CAGACTTAGCACTGTGAACTGGG - Intergenic
1026466164 7:70656655-70656677 CAGAGTTGGCACTGGAGCCTGGG + Intronic
1028526864 7:91796180-91796202 CAGAACTGGAACTGAAGACTTGG - Intronic
1028732140 7:94163446-94163468 CAAAGCTAACAATGTAAACTTGG + Intergenic
1030653936 7:112145517-112145539 CAGCTTTAGCACTGTAAACTGGG - Intronic
1032311861 7:130794856-130794878 CAGTGCTAGCAGTTTACACTTGG + Intergenic
1036927354 8:12919961-12919983 CAAAGCTAGAAATGTAGGCTGGG + Intergenic
1037696775 8:21230398-21230420 CAGAGCTAGTATTGGAGAGTGGG + Intergenic
1038566568 8:28623946-28623968 CATTGCTAGCATTTTAGACTTGG - Intronic
1048182610 8:132210063-132210085 CACAGCTAGCTTTGCAGACTGGG - Intronic
1053013434 9:34648212-34648234 CTGAGCCAGCACTGTGGACATGG + Intronic
1053660322 9:40270583-40270605 CAGAGCTGGAAATGTAGATTAGG + Intronic
1053910695 9:42899937-42899959 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1054361310 9:64123305-64123327 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1054372450 9:64416877-64416899 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1054524278 9:66105641-66105663 CAGAGCTGGAAATGTAGATTAGG - Intergenic
1054680070 9:67906577-67906599 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1055707375 9:79020450-79020472 CAGAGCAATCATTTTAGACTAGG - Intergenic
1057283181 9:93727196-93727218 CAGAGCCAGCACCGTACCCTGGG - Intergenic
1057841835 9:98492297-98492319 CAGACCTAGTACTGTAGATTGGG - Intronic
1058699933 9:107591503-107591525 CAGACCCAGCACTCTTGACTTGG + Intergenic
1058869335 9:109188934-109188956 GGAAGCTAGCACGGTAGACTTGG + Intronic
1059819424 9:117955875-117955897 AAGAGCAAGCACTGGACACTAGG + Intergenic
1060401930 9:123354450-123354472 GAGAGCTGGCACTGTCGCCTTGG + Intergenic
1061935846 9:133857206-133857228 CAGAGCTAGCCCTCCAGATTGGG - Intronic
1203693289 Un_GL000214v1:66150-66172 CAGAGCTGGAAATGTAGATTTGG - Intergenic
1203706262 Un_KI270742v1:51389-51411 CAGAGCTGGAAATGTAGATTAGG + Intergenic
1203557739 Un_KI270744v1:14516-14538 CAGAGCTGGAAATGTAGATTTGG - Intergenic
1203642984 Un_KI270751v1:37913-37935 CAGAGCTGGAAATGTAGATTTGG + Intergenic
1189555918 X:42145251-42145273 CAGACGTAGCTGTGTAGACTGGG - Intergenic
1190938868 X:55020956-55020978 CAGAGCTGGCAGTGGAAACTTGG - Intronic
1195259807 X:103121114-103121136 CAGGGCTAGAAATGTAGGCTGGG - Intergenic
1195703092 X:107719578-107719600 CAGAGCTAGAACTGCAGCCCAGG + Intronic
1195777895 X:108427821-108427843 AAGAGATAGCACAGTAGAGTGGG + Intronic
1197171998 X:123444732-123444754 AAGAGCTAGCACTTCAGTCTGGG - Intronic
1197884681 X:131205841-131205863 CATAGCCAGAACTGTAGTCTAGG - Intergenic
1198595280 X:138229323-138229345 CAGAGCTAGAACTGGAGCCAAGG - Intergenic