ID: 1091606282

View in Genome Browser
Species Human (GRCh38)
Location 12:1954676-1954698
Sequence CAGAGCTAGCACTGTAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091606282_1091606285 -8 Left 1091606282 12:1954676-1954698 CCCAGTCTACAGTGCTAGCTCTG 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1091606285 12:1954691-1954713 TAGCTCTGCATCTGGCACAGAGG 0: 1
1: 0
2: 7
3: 26
4: 256
1091606282_1091606286 -5 Left 1091606282 12:1954676-1954698 CCCAGTCTACAGTGCTAGCTCTG 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1091606286 12:1954694-1954716 CTCTGCATCTGGCACAGAGGAGG 0: 1
1: 0
2: 4
3: 46
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091606282 Original CRISPR CAGAGCTAGCACTGTAGACT GGG (reversed) Intronic