ID: 1091608848

View in Genome Browser
Species Human (GRCh38)
Location 12:1985511-1985533
Sequence CAGTTTTACCTCACAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091608845_1091608848 15 Left 1091608845 12:1985473-1985495 CCAAGAATTTCTATCTTTCCATT 0: 1
1: 0
2: 6
3: 94
4: 631
Right 1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG 0: 1
1: 0
2: 0
3: 11
4: 164
1091608844_1091608848 27 Left 1091608844 12:1985461-1985483 CCTATTTTTGTGCCAAGAATTTC 0: 1
1: 1
2: 2
3: 24
4: 276
Right 1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG 0: 1
1: 0
2: 0
3: 11
4: 164
1091608846_1091608848 -3 Left 1091608846 12:1985491-1985513 CCATTCTTTTCAAGAGTATCCAG 0: 1
1: 0
2: 1
3: 21
4: 220
Right 1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091608848 Original CRISPR CAGTTTTACCTCACAGAGCA TGG Intronic
900190857 1:1351630-1351652 CAGTTCTCCCTCTCAGAGCCCGG - Intergenic
902686783 1:18082485-18082507 CAGTTTTACCTCCCTGCCCATGG - Intergenic
903302654 1:22390341-22390363 CAGTTCCGCCTCACAGAGCAGGG - Intergenic
903576061 1:24340612-24340634 CAGGCTTACCTCACTCAGCAGGG + Intronic
903663189 1:24991188-24991210 CATTGTTACCTCACCCAGCAGGG - Intergenic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
907526687 1:55057861-55057883 CTGTCTTACCTCACTGAGTAAGG + Intronic
909092633 1:71245793-71245815 CAGTTTTAAGTGGCAGAGCAAGG - Intergenic
911289505 1:96039730-96039752 CATTTTTTCCTCACAAATCAAGG - Intergenic
911429614 1:97767386-97767408 CAGTTTAAATTCACAGAGTAGGG - Intronic
911554371 1:99325448-99325470 CTGTTTTACCTCACAGGACTTGG - Intergenic
914725702 1:150325574-150325596 TATTTTCACCTCACAGGGCAAGG + Intronic
915099889 1:153491489-153491511 GAGTTTTTCCTCATAGAGGAAGG + Intergenic
921578968 1:216873661-216873683 CATTTTTTCCACACAGTGCAAGG + Intronic
921934548 1:220785119-220785141 CACTTTTACCTCACAGGGTGCGG - Intergenic
923551071 1:234963825-234963847 CAGTATTCCTTCACAGAGCCAGG + Intergenic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1062901319 10:1148878-1148900 CAGTTTTATCCTACAGACCAGGG - Intergenic
1064548987 10:16479567-16479589 AAGTGTTACATCACAGAGCGCGG - Intronic
1065457424 10:25921916-25921938 CAGTTATACTTTATAGAGCATGG - Intergenic
1065799994 10:29343575-29343597 CTTTCTTACCTTACAGAGCAAGG + Intergenic
1066264871 10:33766815-33766837 CAGTTTCACATCTCAGAACATGG + Intergenic
1066298732 10:34078663-34078685 CAGATTTTCCTCCCAGGGCATGG - Intergenic
1066411914 10:35179725-35179747 CAGTTTTTCCTAAAAGAGAATGG + Intronic
1070424524 10:76272401-76272423 CTGTTTCTCCTCACAGACCATGG - Intronic
1070972497 10:80579069-80579091 GATTTTTACCCCACAGAGAAGGG + Intronic
1079684531 11:23341355-23341377 AACTTTTACCTTACAGAGGATGG + Intergenic
1081099313 11:38982545-38982567 CAGCTTGGCCTCACAGGGCAGGG - Intergenic
1081741165 11:45441783-45441805 CAGTTTCATCTCTCAGGGCAGGG - Intergenic
1084444275 11:69194418-69194440 CAGTCCTACCTCACAGGGCTGGG + Intergenic
1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG + Intronic
1087677668 11:101181356-101181378 CATTTCAACCTCACTGAGCATGG - Intergenic
1088565584 11:111169098-111169120 CTGTTTTCACTCAAAGAGCAAGG - Intergenic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1092283692 12:7116250-7116272 CAGTTTGACCTCCCAGGGTAAGG - Intergenic
1093446890 12:19269996-19270018 CATTTTTTCCTCAGAAAGCAAGG + Intronic
1093746470 12:22747629-22747651 CAGTTTTAACTGACACAGTACGG + Intergenic
1096564694 12:52468941-52468963 CAGCTCTACCTCGGAGAGCAGGG + Exonic
1099407230 12:82279813-82279835 CAGTTTTTCCTCACAAATAAAGG + Intronic
1099770608 12:87048918-87048940 CCCTTTTAGCTGACAGAGCAAGG - Intergenic
1102132007 12:110539032-110539054 CTGTGTCACCACACAGAGCACGG + Intronic
1103920741 12:124397928-124397950 CAGTTTTACCTTCCAGAAAATGG - Intronic
1106007045 13:25780658-25780680 CAGTTTTTCCACAGAGGGCATGG + Intronic
1106501708 13:30335429-30335451 CATTCTTACCTCCCAGAGCCCGG + Intergenic
1107732641 13:43364257-43364279 CAGCTTTTCCTAACAGGGCATGG - Intronic
1109670700 13:65603005-65603027 CAGTTTTACCTATTACAGCAAGG - Intergenic
1112108142 13:96264669-96264691 CAGTTTTATTTTACAGTGCAGGG + Intronic
1112758396 13:102666338-102666360 CAGTATTATCTCACAGAAAAAGG + Intronic
1112826144 13:103394254-103394276 GTGTTTTACATCACAGAGAATGG - Intergenic
1114287853 14:21262081-21262103 CTTTTTGACCTCACAAAGCAGGG - Intronic
1115394955 14:32897931-32897953 CAATTTGACCTCACAGACCTAGG + Intergenic
1116327084 14:43543504-43543526 TAGTTTTACTTCCCAGAGAAGGG + Intergenic
1116684825 14:48025222-48025244 TACTTTTGCCTCACAGAGGAAGG + Intergenic
1118902548 14:69998913-69998935 CAGATTTAACTCACAGGGCCAGG - Intronic
1121254642 14:92522194-92522216 GACTTTTACCTAACAGAGGAGGG - Intronic
1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG + Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1125171999 15:36776217-36776239 CAGTCTTACCTCACAGATTTAGG + Intronic
1128508701 15:68300149-68300171 TAGAATTACCTCACAGAGCTTGG + Intronic
1129319219 15:74764654-74764676 CAGCTTCCCCTCACAGAGCACGG - Intergenic
1131519634 15:93103934-93103956 CAGTTTAAAATGACAGAGCAAGG - Intergenic
1133320497 16:4910580-4910602 CAGGTTCCTCTCACAGAGCAGGG + Intronic
1134301792 16:12998213-12998235 CAGGTTTACTTCATAGAGCCTGG + Intronic
1140468304 16:75199719-75199741 CAGTTCTCCCTCACTGAGCTGGG + Intergenic
1144000300 17:11048168-11048190 CAGTTATGCCTCATGGAGCATGG + Intergenic
1147889464 17:43707078-43707100 AAGTTTTACCTGAGACAGCAGGG + Intergenic
1148879296 17:50713441-50713463 CATTTTTTCCTCACATGGCATGG + Intergenic
1151871251 17:76838379-76838401 CATCTTTAACTCACAGTGCAGGG + Intergenic
1157179562 18:45484467-45484489 CATATATATCTCACAGAGCAGGG + Intronic
1164507036 19:28869476-28869498 AGGTCTTACCTCACAGAACAGGG - Intergenic
1164841466 19:31396188-31396210 CTGTTTTAGTTCACACAGCATGG - Intergenic
1165021598 19:32928850-32928872 CAGTCTCAGATCACAGAGCAGGG - Intronic
1167609472 19:50500376-50500398 CCGATTTAGCTCACAGAGCCGGG - Intergenic
1168430477 19:56275350-56275372 CAGCTTTTCCTTACAGAGAAAGG - Intronic
925716308 2:6787118-6787140 TAGTTTTCACTCACTGAGCAAGG - Intergenic
926799759 2:16649787-16649809 CAGTTATACAGTACAGAGCACGG + Intronic
927383088 2:22501250-22501272 CTGTTTTAACTCACAGATCTTGG - Intergenic
930205432 2:48583005-48583027 CAGTCTTATTTCAAAGAGCAGGG - Intronic
930650141 2:53956163-53956185 CAGTTTTACCACCCAGAGGTAGG - Intronic
932025111 2:68124691-68124713 CAGATTATCCTCACAGTGCATGG - Intronic
937721458 2:125101589-125101611 CTTTCTTACCTGACAGAGCAAGG + Intergenic
941172501 2:162156492-162156514 CAGTTTTATCAAACAGAGCTAGG - Intergenic
941990169 2:171547913-171547935 CAGTATTACCTAGCAGACCAGGG + Intronic
945906489 2:215599593-215599615 CTGTTCCACCTCACAGAGCTAGG - Intergenic
946766310 2:223044340-223044362 CAGATTTTCATCACAGGGCAGGG - Intergenic
947639607 2:231699587-231699609 CAGTGTTATCTCACTGGGCACGG - Intergenic
947887192 2:233583092-233583114 CACTGACACCTCACAGAGCAGGG - Intergenic
948606925 2:239141652-239141674 CAGCTTGACATCAGAGAGCAGGG - Intronic
1169418326 20:5437265-5437287 TACTTTCACCTCACAAAGCAAGG + Intergenic
1170582994 20:17712731-17712753 CATTATTACCCCACAGAGAAGGG - Intronic
1171054063 20:21888408-21888430 CAGTGACACCTCACACAGCAGGG + Intergenic
1178180109 21:30150339-30150361 CAGTCCTACCTGACACAGCATGG - Intergenic
1178804464 21:35826836-35826858 GAGTTTGGCATCACAGAGCATGG - Intronic
1180144266 21:45910560-45910582 GAGTTTTAGGTCACAGAGAAAGG - Intronic
1182248114 22:28976698-28976720 CAGTTTTACTTCAAATTGCAAGG - Intronic
1182767905 22:32772028-32772050 CAGTTTTAGCCCAGAGAGGATGG + Intronic
1182922732 22:34095060-34095082 AAATTTTACAACACAGAGCAAGG - Intergenic
1185259090 22:49851814-49851836 CAGTGTTACTTCCTAGAGCATGG + Intergenic
949689844 3:6623412-6623434 CATCTGTACCTCACAAAGCAAGG + Intergenic
950818359 3:15731394-15731416 CAGTTTTACATCACATAACCTGG + Intronic
950828517 3:15851037-15851059 CAGTTTTCCCCCACATACCAAGG - Intronic
951985617 3:28617194-28617216 ATGTTTTAACTCACAGATCAAGG + Intergenic
955251516 3:57287612-57287634 CAGAATTACCTCATGGAGCAGGG - Intronic
960068521 3:113402426-113402448 CAGTTTTACCTCACGGTGGCAGG + Intronic
960306337 3:116066165-116066187 CACTTTGTCCTCACAGAGTATGG + Intronic
961159279 3:124708364-124708386 CACCTTTACCTTACAGAGGATGG - Intronic
964271618 3:154962429-154962451 GAGGTTTACCTCACAGAGAATGG - Intergenic
964904494 3:161702614-161702636 CAGTTTTACCTCATTCAGCATGG - Intergenic
968986120 4:3875370-3875392 CCGTTTCACCCCAAAGAGCAAGG - Intergenic
971992413 4:33916332-33916354 CAGCTGTTCCTTACAGAGCAGGG - Intergenic
972279786 4:37590749-37590771 CAGCTTCTCCTCACAGAGAAGGG - Exonic
972716959 4:41656036-41656058 CAATTTTCCCTCATTGAGCAAGG + Intronic
973655561 4:53044295-53044317 CAGATTTACATCACAGCCCAAGG + Intronic
977559881 4:98521306-98521328 CAGTGTTTCTTTACAGAGCAAGG + Intronic
982607570 4:157534202-157534224 TAATTTAACCTTACAGAGCAGGG - Intergenic
983136852 4:164094539-164094561 CACTCTTACCTAAGAGAGCAAGG + Intronic
983628347 4:169825826-169825848 CTGTTATACCTCACTGGGCAGGG - Intergenic
986641058 5:9872806-9872828 TAGTTATACCTGACAGAGTATGG - Intergenic
987855220 5:23411986-23412008 CATTTTTACCTCCCTGAGCCTGG - Intergenic
989214238 5:38887671-38887693 CAGTTTTACATAAAAGAGTATGG - Intronic
989250094 5:39303428-39303450 AGGTTCTACCTAACAGAGCATGG + Intronic
991902039 5:71470455-71470477 AACTTTTTCCTCACAGAGCAAGG + Exonic
995168884 5:109082611-109082633 GAGTTTTACCTCTTAGAGAAAGG + Intronic
996594919 5:125189432-125189454 CAGTTTTGCTTCACAAGGCATGG - Intergenic
996748750 5:126868414-126868436 CTGTTTTACTTCACAGGGCAGGG + Exonic
996947102 5:129083593-129083615 CAGTTTTAGTGCACAGAGGAGGG + Intergenic
996963027 5:129273528-129273550 CACCTTTACTTCATAGAGCAAGG - Intergenic
997404697 5:133635971-133635993 CAGTGTCACCTCATAGTGCATGG + Intergenic
999689520 5:154134709-154134731 CAGCTTTAAGTGACAGAGCAAGG + Intronic
999866095 5:155702073-155702095 CAGCTCTACCTCACAGGCCAAGG + Intergenic
1000812477 5:165879958-165879980 CAGTGTTCACTCACTGAGCATGG + Intergenic
1000966518 5:167664156-167664178 CAGTTGTACTTTACAGAGCCTGG - Intronic
1001720833 5:173855748-173855770 CATTTTTATCTCACTGAGCTGGG - Intergenic
1002581403 5:180211396-180211418 CAGCCTTTGCTCACAGAGCAAGG - Intergenic
1006440037 6:34048285-34048307 CAGCTTTACTTCACAGACGAGGG - Intronic
1008864899 6:56198497-56198519 CAGTCTTACCTCAAAAAGCTGGG + Intronic
1009286744 6:61827999-61828021 CAGGGTTACCTCACAGAACAGGG - Intronic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1012582131 6:100881641-100881663 CATATTTACCTTACAGAGAAGGG - Intergenic
1012623543 6:101378378-101378400 CATTTTTACCTAACACAGAATGG + Intergenic
1014527611 6:122519681-122519703 CACTTTTAACTTACAGAGTAAGG - Intronic
1014600798 6:123409656-123409678 CTGTTTTAACTGACAGAGCAAGG - Intronic
1014732291 6:125046872-125046894 CAGTTATACCTGATAGAGAATGG - Intronic
1018059089 6:160076549-160076571 CCAATTTATCTCACAGAGCAGGG - Intronic
1018735746 6:166686113-166686135 CAGTTCTACCCCACAGAGATGGG + Intronic
1021149442 7:17131504-17131526 CAGTTTAACGAGACAGAGCAAGG - Intergenic
1022895964 7:34750740-34750762 CAGCTGCCCCTCACAGAGCAAGG - Intronic
1025727557 7:64081321-64081343 CAGTTTTACCACAAAGGCCAGGG + Intronic
1026940443 7:74284814-74284836 CAGCTTTCCTTCACACAGCAGGG + Intergenic
1032879080 7:136069406-136069428 CAATTTTCCCTCAAACAGCAGGG - Intergenic
1033667698 7:143458408-143458430 CAATTTTACTTCTCAGAGCTGGG - Intergenic
1034331626 7:150288116-150288138 CAGGGCTACCCCACAGAGCAGGG + Intronic
1036464716 8:8985922-8985944 CATTTGTACCTCACATTGCAGGG - Intergenic
1039218693 8:35302786-35302808 CTGTTTTATCTAACAGAGGATGG - Intronic
1042958310 8:74275775-74275797 CAGTTTTTCTTCACAGAACAAGG + Intronic
1043209028 8:77487379-77487401 CAGTTTTACCTAACACAGATGGG - Intergenic
1043690126 8:83140898-83140920 CAGTTTTACAACCCAGAGCCCGG - Intergenic
1044362865 8:91309068-91309090 CCTTTTTATCTGACAGAGCAAGG + Intronic
1044630162 8:94270711-94270733 CAGCTTTCCCTCTCAGAGGATGG + Intergenic
1048012894 8:130472833-130472855 CAGATTTACCTAACAAAGAATGG + Intergenic
1052099152 9:24422470-24422492 CAGTATTATCTAAGAGAGCAAGG + Intergenic
1052728084 9:32253814-32253836 CAGGTTGACCACACAGACCAAGG + Intergenic
1054734153 9:68733556-68733578 CAGTTTGAGGTCACAGACCAAGG + Intronic
1055403690 9:75951336-75951358 CTGTATTAACTCACAGTGCAGGG - Intronic
1057231016 9:93321301-93321323 CAGTTTTACATCTCAGGGAAGGG - Intronic
1058387042 9:104448831-104448853 CAGTTTTGCCACTTAGAGCAAGG + Intergenic
1058807327 9:108604932-108604954 CATTTTTATGTCAGAGAGCAAGG - Intergenic
1188045239 X:25418503-25418525 CAGTTTTTCCTCATTCAGCATGG + Intergenic
1188137744 X:26510474-26510496 CCCTTTTAGCTAACAGAGCAAGG + Intergenic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1191786089 X:64918501-64918523 CAGTGTAACATCACAGAGCCTGG - Intronic
1191821492 X:65313898-65313920 CACCTTGGCCTCACAGAGCATGG - Intergenic
1193896184 X:87117060-87117082 CACTGACACCTCACAGAGCAGGG + Intergenic
1196061546 X:111412857-111412879 CAGATTTACTTCACATAGAAAGG - Intergenic
1196548486 X:116994104-116994126 CTTTTTCACCTCTCAGAGCATGG + Intergenic
1199426430 X:147706557-147706579 CAGATTTACCTTATAGAGGAAGG + Intergenic