ID: 1091609729

View in Genome Browser
Species Human (GRCh38)
Location 12:1995671-1995693
Sequence GCCCATTTGGGGCAAAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091609729 Original CRISPR GCCCATTTGGGGCAAAGTGT GGG (reversed) Intronic
900156350 1:1204757-1204779 GCCCATTGGGGGCTGAGGGTGGG + Intronic
902236290 1:15059609-15059631 GCAGATTTGGGGCAATGTTTTGG + Intronic
902378732 1:16042656-16042678 GCCACTTTGGGGCAAGATGTTGG - Intergenic
903741684 1:25562174-25562196 GCTCATTTGGGGCAATGGCTGGG + Intronic
910060918 1:83090566-83090588 GTCCCTTTAGAGCAAAGTGTGGG - Intergenic
911053914 1:93694948-93694970 GCCCAGGTGGGCCAGAGTGTAGG - Intronic
912758852 1:112348140-112348162 GCCCACTTTGGCCAAAGTGTTGG - Intergenic
915449299 1:155993670-155993692 GCCCATTTGGGAGAGAGTGGAGG - Intronic
918249564 1:182689790-182689812 GCCCATTTGCGCCCAAGTCTAGG - Intergenic
923632796 1:235664673-235664695 GCCCTTCTGGGGCCAAATGTGGG - Intronic
1063048995 10:2425020-2425042 GTTCATCTGGGGCCAAGTGTAGG + Intergenic
1070056636 10:72941329-72941351 GTCCATCTGGGGAAAAGTGAAGG + Exonic
1070781914 10:79142641-79142663 GCCCCTGTGTGGCCAAGTGTGGG - Intronic
1072546525 10:96443755-96443777 GATCATTTGTGGCAAAGTGAAGG + Intronic
1078707383 11:13758368-13758390 GCCCATTTGGGAAAAGGTATGGG - Intergenic
1083109855 11:60395128-60395150 GCCCATGTGGTACAAAGTGCAGG - Intronic
1084449688 11:69228949-69228971 TCTCATGTGGGGCCAAGTGTGGG - Intergenic
1088490042 11:110378099-110378121 GCCCACTTGGACCAAAGTGCTGG + Intergenic
1089654374 11:119936074-119936096 CCCTATTTGGGGCACAATGTGGG + Intergenic
1091609729 12:1995671-1995693 GCCCATTTGGGGCAAAGTGTGGG - Intronic
1093151733 12:15629285-15629307 CCCCATTTGGAGCAGTGTGTGGG - Intronic
1093619590 12:21273226-21273248 CTCCCTTTGGGGCAAAGTTTGGG - Intronic
1095369420 12:41448941-41448963 GCCCAGTTGGGGCAAAGGAAGGG - Intronic
1097350825 12:58546903-58546925 GTCCTTTTGGGGCAAAGTTCAGG + Intronic
1103939301 12:124493168-124493190 GCCCAGTTGGGGCAAAGGGCAGG + Intronic
1104520383 12:129468995-129469017 GCAGGTTTGGGGCACAGTGTAGG - Intronic
1106883560 13:34158185-34158207 GCCCTTTTGATGAAAAGTGTTGG - Intergenic
1110696767 13:78500127-78500149 GATCTTTTGGGGCAAATTGTAGG + Intergenic
1114126256 14:19729881-19729903 GCCCATTTTTAGCACAGTGTAGG - Intronic
1115738323 14:36359591-36359613 AATCATTTTGGGCAAAGTGTAGG - Intergenic
1119646873 14:76354533-76354555 TCCCATTTGGGTCACAATGTTGG - Intronic
1120083003 14:80236719-80236741 CCCCATTGGGGACACAGTGTGGG + Intronic
1122016041 14:98797445-98797467 GCAAATTTGTGGCAAAGTCTTGG - Intergenic
1122423606 14:101592486-101592508 GCCCCTTTGGGGCAAAAGCTGGG - Intergenic
1126328704 15:47509268-47509290 TCCCAGTTTGGGCACAGTGTAGG - Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1131092039 15:89630568-89630590 GCCCAGTTGTGGCTACGTGTTGG - Intronic
1133648543 16:7787701-7787723 ACCCAATTGGGACCAAGTGTAGG + Intergenic
1134663394 16:16001111-16001133 GCACATTTGGGGAACAGGGTGGG + Intronic
1142846596 17:2682183-2682205 CCTCATTTGGGGAAAAGTGGTGG + Exonic
1143587973 17:7860844-7860866 GACCTTTTGGGGCAAAGAGGTGG + Exonic
1146575649 17:33988927-33988949 AACAATTTGGGGCAAAGTTTTGG - Intronic
1147618076 17:41842690-41842712 GCCCATCTTGGCCAAAGTGCTGG - Intronic
1150521937 17:65877545-65877567 GACCATTTATGGCAAATTGTAGG - Intronic
1153699765 18:7680814-7680836 GCCCATAAGGGGCTAAGTGTGGG + Intronic
1155184155 18:23372777-23372799 GCCTATTTGGAGCAAAGGGGAGG - Intronic
1159718187 18:71851137-71851159 GCCCATGTGGAGCACAGTGTGGG - Intergenic
1162927423 19:13937391-13937413 GCGCATTTGGGGTCAATTGTGGG - Intronic
1162948406 19:14057124-14057146 TTCCATTTGGGGAAAAGTCTGGG - Intronic
1164109080 19:22137832-22137854 GCCCTTTGTGGGCAAAGTGCAGG - Intergenic
1164302018 19:23971432-23971454 GCACATTTGGGGAAAATTGGAGG - Intergenic
1164608781 19:29618388-29618410 GCCCATATGGGGGAAAGAGAAGG - Intergenic
1165527725 19:36370266-36370288 GCCCACTTGGGGAAAAGTCAGGG + Intronic
1166456872 19:42949075-42949097 TCTCATTTGGGGAAAAGTGTGGG + Intronic
1166486623 19:43219573-43219595 TCTCATTTGGGGAAAAGTGTGGG + Intronic
1166493737 19:43283008-43283030 TGTCATTTGGGGAAAAGTGTGGG + Intergenic
1168244777 19:55106759-55106781 AACCATATGGGGCAAAGTGTGGG - Intronic
936226787 2:110661810-110661832 GCACGTATGGGGCCAAGTGTAGG - Exonic
938154415 2:128920379-128920401 AACCATTTAGGGCAAAGAGTAGG - Intergenic
938321974 2:130372023-130372045 GGTAATTTGGGGCAGAGTGTTGG - Intronic
938809989 2:134843994-134844016 GCCCATGTGGAGCAGAGTCTTGG - Intronic
939226324 2:139369498-139369520 TGCCATTTGGGGCACTGTGTGGG + Intergenic
942463478 2:176186049-176186071 GGGCATTTGGGGCAAAGGCTGGG - Intergenic
1169049224 20:2562081-2562103 GCCCCTTTGGGGAAATGTGGAGG - Intronic
1179458698 21:41518426-41518448 GGCCTTTTGGGTCAAACTGTGGG - Intronic
1181403607 22:22666783-22666805 GCCCAGCTGGGGCAAAGAGAAGG + Intergenic
1181413883 22:22745898-22745920 GCCCAGCTGGGGCAAAGAGAAGG + Intronic
1182386781 22:29949940-29949962 ACTGATTTGGGGCAAGGTGTCGG + Intronic
1185014009 22:48333132-48333154 GCCCGTTAGGGGCTAAGTCTGGG - Intergenic
950074004 3:10174312-10174334 GCCCATTTTGTCCAAAGGGTAGG + Intronic
952207846 3:31198278-31198300 GCTCATTTGGGGCAAAGGCCAGG - Intergenic
954196145 3:48998351-48998373 GACCCTTTGGGGGAAAGGGTCGG + Intronic
955516673 3:59732706-59732728 GCGCACTTGGGGCAATGTATTGG - Intergenic
956287651 3:67627630-67627652 GCCCATATGGGGCACACTATAGG + Intronic
956404678 3:68915827-68915849 GCCCATTTTGCACAAAGTGGTGG - Intronic
962103307 3:132365295-132365317 GCCAATTTGGGGTGAAGTGAAGG + Intronic
968218594 3:196915714-196915736 GACTATTTGGGGGAAAGTGAAGG + Intronic
973640972 4:52902240-52902262 GTCCTTCTGGGGCAAACTGTAGG - Intronic
973721755 4:53731162-53731184 TTCCATTTGGGGCAATGTGGTGG - Intronic
975662051 4:76698031-76698053 GCCCATTTGTGGAAAAGTAATGG - Intronic
977037129 4:91968636-91968658 ACCCATATGAGGAAAAGTGTAGG - Intergenic
977446011 4:97133450-97133472 GTTCTTTTGGAGCAAAGTGTAGG - Intergenic
978345506 4:107763980-107764002 GGGGATTTGGGGGAAAGTGTGGG - Intergenic
981367295 4:143917949-143917971 TCCCATGTAGGGCAAAGTGGTGG - Intergenic
987662475 5:20894703-20894725 GCCCATTAGGGACTCAGTGTGGG - Intergenic
989073129 5:37533344-37533366 GCCCATCTCGGCCAAAGTGCTGG - Intronic
989161871 5:38399117-38399139 GCCCACTTGAGGGAAAGTTTGGG + Intronic
1000155912 5:158551631-158551653 GCTCAGTTGGGTCAAAATGTTGG + Intergenic
1002665491 5:180820692-180820714 GCCTATGTGGGGCAGAGAGTGGG + Intergenic
1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG + Intronic
1010284777 6:74063461-74063483 GCCCATATGAGGAAAAGTGCTGG - Intergenic
1017001897 6:150003049-150003071 GTGCATTTGGGGCAAAGTAACGG + Intergenic
1020440993 7:8216217-8216239 GCTCATTTGGGGTCAAGTGCTGG + Intronic
1021470843 7:21001038-21001060 GCCAATTTGTGGCAAAGCTTTGG + Intergenic
1021941259 7:25680914-25680936 GGCTATTTGGGGCAAACAGTGGG - Intergenic
1024000253 7:45184902-45184924 CCCCATTGGGGGCACAGTGTAGG + Intronic
1029285557 7:99463402-99463424 TCCCATCTCGGCCAAAGTGTTGG - Intronic
1034275949 7:149823964-149823986 GCACATTTGGGGCAAGATGAGGG - Intergenic
1034279346 7:149841592-149841614 GCCCTTTTGCTGCAAGGTGTGGG + Intronic
1038923039 8:32106971-32106993 GCCCATCTCGGGCAAAGTACTGG - Intronic
1045479076 8:102578163-102578185 CCTCATTTGGGGCACTGTGTTGG + Intergenic
1048277315 8:133076842-133076864 GGCGACTTGGTGCAAAGTGTGGG + Intronic
1051350774 9:16196157-16196179 GCCCATTTGGTGCCAACTGGGGG + Intergenic
1057953576 9:99389258-99389280 GCCAGTTTGGGGCCAGGTGTGGG - Intergenic
1058706565 9:107642323-107642345 GCCAAGTTGGGGCACAGAGTGGG + Intergenic
1186219126 X:7330987-7331009 GCTTATTTGGGGCACAATGTTGG - Intronic
1186436968 X:9551276-9551298 GCCCTTTTGGGGTAGAGTGGAGG + Intronic
1187295729 X:17998924-17998946 GCCCATTTGGGTCTCAGAGTTGG + Intergenic
1188416246 X:29938517-29938539 GCCTATGTGGGGAGAAGTGTGGG - Intronic
1190297095 X:49034083-49034105 GCTCACCTGGGGTAAAGTGTAGG + Intronic
1192315534 X:70048498-70048520 GAGCATTTGGGGCAGAGAGTGGG - Intronic
1194332676 X:92602190-92602212 ACTCATTTGGAGCAAAGTATGGG + Intronic
1195305039 X:103573765-103573787 CCTCATTTGGAGGAAAGTGTAGG + Intergenic
1196281690 X:113829906-113829928 GCCCATTTTGGGGAATGTTTGGG - Intergenic
1199305887 X:146267407-146267429 GGACATTTGCGGCTAAGTGTTGG - Intergenic
1200641371 Y:5721235-5721257 ACTCATTTGGAGCAAAGTATGGG + Intronic