ID: 1091610436

View in Genome Browser
Species Human (GRCh38)
Location 12:2003477-2003499
Sequence TGTCTCTACATTCGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091610436 Original CRISPR TGTCTCTACATTCGAGTGGG TGG Intronic
900140083 1:1136222-1136244 TGTCTCTTCAGTGGAGTGAGAGG - Intergenic
908356959 1:63331160-63331182 GGTTTCTACATTAGGGTGGGAGG - Intergenic
908818613 1:68058936-68058958 GGTCACTACATTCCAGTGCGTGG - Intergenic
909382726 1:75018397-75018419 TGTCTATACATATGTGTGGGAGG - Intergenic
909652268 1:77988806-77988828 TCTCTGTACATTCTAGTAGGGGG - Intronic
915246507 1:154559213-154559235 TGTCTTCACACTCGGGTGGGTGG + Intergenic
919973064 1:202593158-202593180 TCTTTCTACCTTTGAGTGGGAGG + Exonic
920245897 1:204587334-204587356 TGTATCTTCATTAGAGTCGGGGG + Intergenic
920952777 1:210587899-210587921 TATGTGTACATTCCAGTGGGCGG + Exonic
922786402 1:228284577-228284599 TGGCTCCACATTTGAGTGGCAGG + Intronic
1063519672 10:6729773-6729795 TGTCTTTTCATTCCAGTCGGAGG + Intergenic
1067226987 10:44383003-44383025 TGTCTCTGCATTAGACTGGAGGG - Intronic
1074295920 10:112189307-112189329 TGTCTCTACAATAGGTTGGGTGG - Intronic
1074553423 10:114466489-114466511 TGTTTCTACATTAGTGGGGGAGG - Intronic
1075795125 10:125114794-125114816 TATCTCTGCATTTGGGTGGGTGG - Intronic
1077901333 11:6491591-6491613 GGACCTTACATTCGAGTGGGAGG - Intronic
1078436816 11:11332279-11332301 AGGCTCTGCATGCGAGTGGGAGG + Intronic
1079458602 11:20659799-20659821 TTTCTCTCCTTTTGAGTGGGTGG + Intergenic
1080758604 11:35226268-35226290 TGTCTGTGCATGGGAGTGGGTGG - Intronic
1085999873 11:81970174-81970196 TGTCTCTGCTATCCAGTGGGTGG - Intergenic
1089563303 11:119356830-119356852 TGGCGCTACATTCGGGAGGGCGG + Exonic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091610436 12:2003477-2003499 TGTCTCTACATTCGAGTGGGTGG + Intronic
1091897060 12:4113993-4114015 TGTCTCTACCTTGGCCTGGGTGG + Intergenic
1093598592 12:20993244-20993266 TATCCCTACATTTGAATGGGGGG - Intergenic
1095157262 12:38872479-38872501 TGTCTCCACATTCAAATGGGCGG - Intronic
1097849208 12:64394902-64394924 TGTCTTTAGTTTCAAGTGGGGGG - Intergenic
1099147586 12:79066127-79066149 GGTCTCTGCATTTGTGTGGGTGG - Intronic
1101594305 12:106150390-106150412 TGTCTCTACATTGGAGGGTATGG - Intergenic
1103946870 12:124531843-124531865 TGTCTATACATTGGGGTGAGGGG - Intronic
1107021398 13:35756147-35756169 AGTCTCTGCATCCCAGTGGGGGG - Intergenic
1109123292 13:58485629-58485651 TGTCTTTACATTTGAGTTGAAGG - Intergenic
1111136375 13:84050502-84050524 TGTCTCTGCATTCTAGAGGGAGG + Intergenic
1120707080 14:87756267-87756289 TGTCTCTGCATGAGAGTGTGCGG + Intergenic
1124356669 15:29000568-29000590 TGTCTCTTCATTGAAATGGGTGG + Intronic
1126994319 15:54422558-54422580 TGTGGCTACATTTGAGTGAGAGG - Intronic
1128380639 15:67109529-67109551 TGTCTTTGCATTCTAGTGGGTGG + Intronic
1128968534 15:72086044-72086066 TGTCACTACACTCCAGCGGGTGG + Intronic
1133447085 16:5870869-5870891 TGTCTCTACTTGGGGGTGGGGGG - Intergenic
1133470106 16:6066817-6066839 TGTCTCTACCTCTGAGTGGAGGG - Intronic
1135794511 16:25428416-25428438 TGACTTTACATTCTAGTGGAGGG + Intergenic
1138016811 16:53435370-53435392 TGTGTCTACATCCGGGTCGGCGG - Intronic
1138609008 16:58108218-58108240 TGGCTCCACATTTGAGTGAGTGG - Intergenic
1143357892 17:6344133-6344155 TGAGTATACATTCTAGTGGGAGG - Intergenic
1148271398 17:46264794-46264816 TGTCTCTACATTTCAGGGTGTGG + Intergenic
1153835893 18:8963369-8963391 TGTCTGTACATTCCTGTGTGTGG - Intergenic
1159556316 18:69949050-69949072 TGTGACTACAGTCTAGTGGGTGG + Intronic
1164621200 19:29696977-29696999 TGTCTGGATATTCGAGTGGCAGG + Intergenic
1164686694 19:30171518-30171540 TGTGTGTACATGCGAGTGAGTGG + Intergenic
1166987396 19:46669433-46669455 TGTGAGTACAGTCGAGTGGGTGG + Intergenic
1168462242 19:56568550-56568572 TTTCTCTTTATTGGAGTGGGAGG - Intronic
926348130 2:11968224-11968246 TGTTTCTCCCTTCGAGTGAGAGG + Intergenic
928013086 2:27629023-27629045 TGTCTCTATGGTCGGGTGGGTGG + Exonic
929316624 2:40486874-40486896 TGTCTCTACAAAGGGGTGGGGGG - Intronic
934084337 2:88497428-88497450 TCTCTCTATATTCAAGTTGGAGG + Intergenic
938176463 2:129135805-129135827 TATCTCTCCATTGGAGTGGGAGG + Intergenic
941042159 2:160634723-160634745 TGTCTATATATGCCAGTGGGTGG + Intergenic
946409214 2:219508125-219508147 TCTCTCTTCATGGGAGTGGGAGG + Intergenic
1169412232 20:5381532-5381554 TGTCACTACAAGGGAGTGGGGGG + Intergenic
1169717494 20:8636898-8636920 TGTCTCTGCAATGGAGTGGATGG - Intronic
1174272396 20:49379176-49379198 TGTCTCTCCATTTGGGTGGCGGG - Intronic
1174842400 20:53912445-53912467 TGTATCTACATGTGAGAGGGAGG + Intergenic
1179245325 21:39628485-39628507 TGTCTCAACATTTTAGTGGGAGG + Intronic
1179286954 21:39985684-39985706 TGTATGTACATTTGCGTGGGTGG - Intergenic
1180128188 21:45805993-45806015 TGTCTCAGCATTAGAGAGGGCGG + Intronic
1182631872 22:31692347-31692369 TTTCTTTACATCCTAGTGGGTGG + Intronic
949561059 3:5203070-5203092 GGACTCCACATTTGAGTGGGTGG + Exonic
951198196 3:19847390-19847412 TGTCTCTACAAACGACAGGGTGG + Intergenic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
955493247 3:59504205-59504227 TGTATTTACATTCCAGTGTGGGG - Intergenic
956688983 3:71858681-71858703 TGGCTCTAAATTAGATTGGGAGG + Intergenic
959421696 3:106136268-106136290 GGTCACTACATTCCAATGGGTGG - Intergenic
969602424 4:8184256-8184278 TGTCTCAATGTTGGAGTGGGCGG - Intronic
975857283 4:78637905-78637927 TGTCTGTTCATTCTAGTGGATGG + Intergenic
975857326 4:78638506-78638528 TGTCTGTTCATTCTAGTGGATGG + Intergenic
980689475 4:136275971-136275993 TGTTGCTACATTGGAGTGGTAGG + Intergenic
980747270 4:137034688-137034710 GGTCTCTACTTGCGAGTGGAGGG + Intergenic
983476818 4:168222126-168222148 TGTTTCTATATTCTAGTGGATGG - Intronic
985972261 5:3387872-3387894 TGTCTCTACCCTTGTGTGGGCGG + Intergenic
990097523 5:52135519-52135541 TTTCTCTCCATTCCAGAGGGTGG + Intergenic
990961754 5:61400867-61400889 TGTCTTTACATTTGACTGGTGGG + Intronic
996191905 5:120554903-120554925 TGTCTCCACATTCCAGTAAGGGG + Intronic
997182154 5:131841260-131841282 GGTCTCTACAATCCAATGGGTGG + Intronic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1018388634 6:163326942-163326964 TGTCTCAACATAAGATTGGGTGG - Intergenic
1018388656 6:163327070-163327092 TGTCTCAACATAAGATTGGGTGG - Intergenic
1020968920 7:14908327-14908349 TGTCTCTACATTAGACTTAGAGG + Intronic
1021579393 7:22136854-22136876 TCTTTCTACATTATAGTGGGTGG - Intronic
1023895632 7:44430824-44430846 AGTCTCTGCCTTCGAGTGAGGGG + Intronic
1027433837 7:78142728-78142750 TGTCTAGACATTAGAGTGGCAGG + Intronic
1034950451 7:155293128-155293150 TGACTCTGCATTGGAGTGGAGGG - Intergenic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1040280596 8:46039934-46039956 GGTCTCTCCACTCGTGTGGGGGG - Intergenic
1040567761 8:48582554-48582576 TGTTTCCAGATTCGTGTGGGAGG - Intergenic
1043198860 8:77337474-77337496 TGTCTCAACCTTCAAGTAGGTGG - Intergenic
1044240785 8:89886400-89886422 TTTGTTTACATTCTAGTGGGTGG + Intergenic
1045719786 8:105095034-105095056 TGTCTCTACCTTAGATTAGGAGG - Intronic
1046763321 8:118043658-118043680 TGTGTCTGCATTGGAGTTGGAGG - Intronic
1056972239 9:91215739-91215761 CCTCTCTACATTGCAGTGGGAGG + Intronic
1187220739 X:17323589-17323611 TGCCACTACACTCCAGTGGGTGG - Intergenic
1191104696 X:56765239-56765261 TGTCTCCATATTGCAGTGGGTGG + Intergenic
1196151564 X:112380611-112380633 TGTCTCTATGGTCGGGTGGGCGG - Intergenic